Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-19b URS000013D17D_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-19b: Ssc-mir-19b is a microRNA that has been predicted to target various genes in different studies. In one study, it was predicted to target the transporter gene SLC6A6, while in another study, it was predicted to target GCLC, which is necessary for glutathione synthesis [PMC7426424]. Ssc-mir-19b was also found to be down-regulated in exosome-like vesicles and predicted to target NRF2 [PMC7426424]. In a different study, ssc-mir-19b was found to be activated in hpiPSCs compared with pEFs [PMC4934789]. Ssc-mir-19b is one of the six candidate miRNAs that play a role in the urea cycle [PMC5043173]. It has also been found to have higher expression levels in LP compared to NP [PMC5043173]. Furthermore, ssc-mir-19b has been shown to reduce the luciferase activity of the wild-type SIRT5 reporter [PMC5043173]. It has also been identified as one of the miRNAs that have stringent target sites along the PRRSV genome sequences [PMC9651005]. Ssc-mir-19b has been found to target TNFα and IL-20 in pigs [PMC4778948]. Additionally, ssc-mir-19b is located on chromosome X and is produced from the same precursor as ssc-miR-361-5p and ssc-miR-361-3p [PMC3579806]. It has also been identified as one of the differentially expressed miRNAs in various pig breeds such as Iberian breed and Landrace breed [PMC3555835]. In studies on PRV-infected cells, ssc-mir-19b was found to be downregulated [PMC4545981]. The differential expression of ssc-mir-19b has also been confirmed in PRV-infected PK-15 cells [PMC7329775]. Finally, ssc-mir-19b has been identified as one of the differentially expressed miRNAs in the CK and JK groups [PMC9275911].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCCAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis Ami-Mir-19-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P2c_3p (mature (guide))
  3. Ateles geoffroyi age-miR-19b
  4. Bos taurus (cattle) bta-miR-19b
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-19b
  6. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
  7. Canis lupus familiaris (dog) Cfa-Mir-19-P2c_3p (mature (guide))
  8. Capra hircus chi-miR-19b-3p
  9. Cavia porcellus (domestic guinea pig) cpo-miR-19b-3p
  10. Cervus elaphus (red deer) cel-miR-19b
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P2a_3p (mature (guide))
  12. Columba livia cli-miR-19b-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19b-3p
  14. Danio rerio dre-miR-19b-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
  16. Echinops telfairi Ete-Mir-19-P2c_3p (mature (guide))
  17. Eptatretus burgeri (inshore hagfish) Ebu-Mir-19-P2e_3p (mature (guide))
  18. Equus caballus eca-miR-19b
  19. Gadus morhua (Atlantic cod) gmo-miR-19b-3p
  20. Gallus gallus (chicken) gga-miR-19b-3p
  21. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-19b (MIR19B-2)
  23. Gorilla gorilla ggo-miR-19b
  24. Homo sapiens hsa-miR-19b-3p
  25. Lagothrix lagotricha lla-miR-19b
  26. Latimeria chalumnae (coelacanth) Lch-Mir-19-P2c_3p (mature (guide))
  27. Lemur catta lca-miR-19b
  28. Lepisosteus oculatus Loc-Mir-19-P2a_3p (mature (guide))
  29. Macaca mulatta (Rhesus monkey) mml-miR-19b
  30. Macaca nemestrina (pig-tailed macaque) mne-miR-19b
  31. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
  32. Monodelphis domestica mdo-miR-19b-3p
  33. Monopterus albus (swamp eel) Mal-Mir-19-P2a1_3p (mature (guide))
  34. Mus musculus (house mouse) mmu-miR-19b-3p
  35. Ophiophagus hannah (king cobra) oha-miR-19b-3p
  36. Ornithorhynchus anatinus oan-miR-19b-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
  38. Ovis aries (sheep) oar-miR-19b
  39. Pan paniscus (pygmy chimpanzee) ppa-miR-19b
  40. Pan troglodytes (chimpanzee) ptr-miR-19b
  41. Petromyzon marinus pma-miR-19b-3p
  42. Pongo pygmaeus ppy-miR-19b
  43. Pteropus alecto pal-miR-19-3p
  44. Python bivittatus (Burmese python) Pbv-Mir-19-P2c_3p (mature (guide))
  45. Rattus norvegicus rno-miR-19b-3p
  46. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19b
  47. Sarcophilus harrisii Sha-Mir-19-P2c_3p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2c_3p (mature (guide))
  49. Sphenodon punctatus Spt-Mir-19-P2c_3p (mature (guide))
  50. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
  51. Takifugu rubripes fru-miR-19b
  52. Tetraodon nigroviridis tni-miR-19b
  53. Tor tambroides miR-19b-3p
  54. Tupaia chinensis (Chinese tree shrew) tch-miR-19b-3p
  55. Xenopus laevis xla-miR-19b
  56. Xenopus tropicalis xtr-miR-19b
Publications