Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-19b URS000013D17D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-19b: Bta-mir-19b is a microRNA that has been identified in various studies and is associated with different biological functions and pathways. It has been found to be abundantly expressed in LPS- and CpG-treated samples, as well as in control samples [PMC7903524, PMC4892552]. Bta-mir-19b has also been reported to be associated with Wnt signals and the MAPK pathway [PMC9445238]. In some studies, the expression of bta-mir-19b was found to be differentially expressed after MAP infection [PMC6600136]. Additionally, bta-mir-19b has putative target sites in the 3'UTR region of genes such as BEDNRB, IGFBP3, POSTN, and DHRS3 [PMC5003961]. It has also been identified as one of the miRNAs that are differentially expressed between moderate and high fertility groups [PMC9113469]. Furthermore, bta-mir-19b was found to be upregulated in non-pregnant cows compared to pregnant cows [PMC7458322]. In relation to disease conditions, bta-mir-19b has been associated with human tuberculosis and inflammatory bowel disease [PMC5070780]. It was also found to target genes such as HIC1, TBC1D8, IMPDH1, and ZBTB4 in different groups [PMC5070780]. Overall, bta-mir-19b is a versatile microRNA that plays a role in various biological processes and disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCCAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis Ami-Mir-19-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P2c_3p (mature (guide))
  3. Ateles geoffroyi age-miR-19b
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-19b
  5. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-19-P2c_3p (mature (guide))
  7. Capra hircus chi-miR-19b-3p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-19b-3p
  9. Cervus elaphus (red deer) cel-miR-19b
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P2a_3p (mature (guide))
  11. Columba livia cli-miR-19b-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-19b-3p
  13. Danio rerio dre-miR-19b-3p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
  15. Echinops telfairi Ete-Mir-19-P2c_3p (mature (guide))
  16. Eptatretus burgeri (inshore hagfish) Ebu-Mir-19-P2e_3p (mature (guide))
  17. Equus caballus eca-miR-19b
  18. Gadus morhua (Atlantic cod) gmo-miR-19b-3p
  19. Gallus gallus (chicken) gga-miR-19b-3p
  20. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19b (MIR19B-2)
  22. Gorilla gorilla ggo-miR-19b
  23. Homo sapiens hsa-miR-19b-3p
  24. Lagothrix lagotricha lla-miR-19b
  25. Latimeria chalumnae (coelacanth) Lch-Mir-19-P2c_3p (mature (guide))
  26. Lemur catta lca-miR-19b
  27. Lepisosteus oculatus Loc-Mir-19-P2a_3p (mature (guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-19b
  29. Macaca nemestrina (pig-tailed macaque) mne-miR-19b
  30. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
  31. Monodelphis domestica mdo-miR-19b-3p
  32. Monopterus albus (swamp eel) Mal-Mir-19-P2a1_3p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-19b-3p
  34. Ophiophagus hannah (king cobra) oha-miR-19b-3p
  35. Ornithorhynchus anatinus oan-miR-19b-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
  37. Ovis aries (sheep) oar-miR-19b
  38. Pan paniscus (pygmy chimpanzee) ppa-miR-19b
  39. Pan troglodytes (chimpanzee) ptr-miR-19b
  40. Petromyzon marinus pma-miR-19b-3p
  41. Pongo pygmaeus ppy-miR-19b
  42. Pteropus alecto pal-miR-19-3p
  43. Python bivittatus (Burmese python) Pbv-Mir-19-P2c_3p (mature (guide))
  44. Rattus norvegicus rno-miR-19b-3p
  45. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19b
  46. Sarcophilus harrisii Sha-Mir-19-P2c_3p (mature (guide))
  47. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2c_3p (mature (guide))
  48. Sphenodon punctatus Spt-Mir-19-P2c_3p (mature (guide))
  49. Sus scrofa ssc-miR-19b
  50. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
  51. Takifugu rubripes fru-miR-19b
  52. Tetraodon nigroviridis tni-miR-19b
  53. Tor tambroides miR-19b-3p
  54. Tupaia chinensis (Chinese tree shrew) tch-miR-19b-3p
  55. Xenopus laevis xla-miR-19b
  56. Xenopus tropicalis xtr-miR-19b
Publications