Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-19b URS000013D17D_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-19b: Oar-mir-19b is a downregulated miRNA that has been studied in various contexts. In one study, steam-loop real-time qPCR was used to validate miRNA sequencing data, and oar-mir-19b was one of the miRNAs that were validated [PMC10035661]. Another study focused on the functional annotations and enrichment of differentially expressed miRNAs, and oar-mir-19b was found to be related to open rectifier potassium channel activity, gap junction channel activity, anion binding, as well as the VEGF signaling pathway and apoptosis signaling pathway [PMC5611885]. The expression of oar-mir-19b was found to be significantly different between an unloading group and a control group [PMC5611885]. In another study, the expression of oar-mir-19b was validated using the Fluidigm Biomark HD Nanofluidic qPCR system, confirming its downregulated expression [PMC6206264]. Furthermore, oar-mir-19b has been found to target TNF in early pregnancy [PMC9428447]. It is worth noting that in another context, oar-miR-329a-5p was found to be downregulated between C12 and P12 [PMC9428447]. Additionally, CTNNB1 is one of the hub genes targeted by oar-mir-19b [PMC9428447]. Overall, these studies highlight the importance of oar-mir-19b in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCCAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis Ami-Mir-19-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P2c_3p (mature (guide))
  3. Ateles geoffroyi age-miR-19b
  4. Bos taurus (cattle) bta-miR-19b
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-19b
  6. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
  7. Canis lupus familiaris (dog) Cfa-Mir-19-P2c_3p (mature (guide))
  8. Capra hircus chi-miR-19b-3p
  9. Cavia porcellus (domestic guinea pig) cpo-miR-19b-3p
  10. Cervus elaphus (red deer) cel-miR-19b
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P2a_3p (mature (guide))
  12. Columba livia cli-miR-19b-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19b-3p
  14. Danio rerio dre-miR-19b-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
  16. Echinops telfairi Ete-Mir-19-P2c_3p (mature (guide))
  17. Eptatretus burgeri (inshore hagfish) Ebu-Mir-19-P2e_3p (mature (guide))
  18. Equus caballus eca-miR-19b
  19. Gadus morhua (Atlantic cod) gmo-miR-19b-3p
  20. Gallus gallus (chicken) gga-miR-19b-3p
  21. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-19b (MIR19B-2)
  23. Gorilla gorilla ggo-miR-19b
  24. Homo sapiens hsa-miR-19b-3p
  25. Lagothrix lagotricha lla-miR-19b
  26. Latimeria chalumnae (coelacanth) Lch-Mir-19-P2c_3p (mature (guide))
  27. Lemur catta lca-miR-19b
  28. Lepisosteus oculatus Loc-Mir-19-P2a_3p (mature (guide))
  29. Macaca mulatta (Rhesus monkey) mml-miR-19b
  30. Macaca nemestrina (pig-tailed macaque) mne-miR-19b
  31. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
  32. Monodelphis domestica mdo-miR-19b-3p
  33. Monopterus albus (swamp eel) Mal-Mir-19-P2a1_3p (mature (guide))
  34. Mus musculus (house mouse) mmu-miR-19b-3p
  35. Ophiophagus hannah (king cobra) oha-miR-19b-3p
  36. Ornithorhynchus anatinus oan-miR-19b-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
  38. Pan paniscus (pygmy chimpanzee) ppa-miR-19b
  39. Pan troglodytes (chimpanzee) ptr-miR-19b
  40. Petromyzon marinus pma-miR-19b-3p
  41. Pongo pygmaeus ppy-miR-19b
  42. Pteropus alecto pal-miR-19-3p
  43. Python bivittatus (Burmese python) Pbv-Mir-19-P2c_3p (mature (guide))
  44. Rattus norvegicus rno-miR-19b-3p
  45. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19b
  46. Sarcophilus harrisii Sha-Mir-19-P2c_3p (mature (guide))
  47. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2c_3p (mature (guide))
  48. Sphenodon punctatus Spt-Mir-19-P2c_3p (mature (guide))
  49. Sus scrofa ssc-miR-19b
  50. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
  51. Takifugu rubripes fru-miR-19b
  52. Tetraodon nigroviridis tni-miR-19b
  53. Tor tambroides miR-19b-3p
  54. Tupaia chinensis (Chinese tree shrew) tch-miR-19b-3p
  55. Xenopus laevis xla-miR-19b
  56. Xenopus tropicalis xtr-miR-19b
Publications