v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-19b URS000013D17D_9544

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGUGCAAAUCCAUGCAAAACUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 110 other species

    1. Alligator mississippiensis Ami-Mir-19-P2c_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-19-P2c_3p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-19b
    4. Bos taurus (cattle) bta-miR-19b
    5. Callithrix jacchus cja-miR-19b
    6. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
    7. Canis lupus familiaris Cfa-Mir-19-P2c_3p (mature (guide))
    8. Capra hircus (goat) chi-miR-19b-3p
    9. Cavia porcellus cpo-miR-19b-3p
    10. Cervus elaphus cel-miR-19b
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P2a_3p (mature (guide))
    12. Columba livia cli-miR-19b-3p
    13. Cricetulus griseus cgr-miR-19b-3p
    14. Danio rerio (zebrafish) dre-miR-19b-3p
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
    16. Echinops telfairi Ete-Mir-19-P2c_3p (mature (guide))
    17. Eptatretus burgeri (inshore hagfish) Ebu-Mir-19-P2e_3p (mature (guide))
    18. Equus caballus (horse) eca-miR-19b
    19. Gadus morhua gmo-miR-19b-3p
    20. Gallus gallus (chicken) gga-miR-19b-3p
    21. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
    22. Gorilla gorilla ggo-miR-19b
    23. Homo sapiens (human) hsa-miR-19b-3p
    24. Lagothrix lagotricha (brown woolly monkey) lla-miR-19b
    25. Latimeria chalumnae Lch-Mir-19-P2c_3p (mature (guide))
    26. Lemur catta (Ring-tailed lemur) lca-miR-19b
    27. Lepisosteus oculatus Loc-Mir-19-P2a_3p (mature (guide))
    28. Macaca nemestrina (pig-tailed macaque) mne-miR-19b
    29. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
    30. Monodelphis domestica mdo-miR-19b-3p
    31. Monopterus albus (swamp eel) Mal-Mir-19-P2a1_3p (mature (guide))
    32. Mus musculus mmu-miR-19b-3p
    33. Ophiophagus hannah (king cobra) oha-miR-19b-3p
    34. Ornithorhynchus anatinus (platypus) oan-miR-19b-3p
    35. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
    36. Ovis aries (sheep) oar-miR-19b
    37. Pan paniscus ppa-miR-19b
    38. Pan troglodytes ptr-miR-19b
    39. Petromyzon marinus (sea lamprey) pma-miR-19b-3p
    40. Pongo pygmaeus (Bornean orangutan) ppy-miR-19b
    41. Pteropus alecto pal-miR-19-3p
    42. Python bivittatus Pbv-Mir-19-P2c_3p (mature (guide))
    43. Rattus norvegicus (Norway rat) rno-miR-19b-3p
    44. Saguinus labiatus sla-miR-19b
    45. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P2c_3p (mature (guide))
    46. Scyliorhinus torazame Sto-Mir-19-P2c_3p (mature (guide))
    47. Sphenodon punctatus Spt-Mir-19-P2c_3p (mature (guide))
    48. Sus scrofa (pig) ssc-miR-19b
    49. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
    50. Takifugu rubripes (torafugu) fru-miR-19b
    51. Tetraodon nigroviridis tni-miR-19b
    52. Tor tambroides miR-19b-3p
    53. Tupaia chinensis (Chinese tree shrew) tch-miR-19b-3p
    54. Xenopus laevis (African clawed frog) xla-miR-19b
    55. Xenopus tropicalis (tropical clawed frog) xtr-miR-19b
    56. Gorilla gorilla gorilla None
     Publications