Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P2c_3p (mature (guide)) URS000013D17D_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCCAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 111 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-19-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P2c_3p (mature (guide))
  3. Ateles geoffroyi age-miR-19b
  4. Bos taurus bta-miR-19b
  5. Callithrix jacchus cja-miR-19b
  6. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
  7. Canis lupus familiaris (dog) Cfa-Mir-19-P2c_3p (mature (guide))
  8. Capra hircus chi-miR-19b-3p
  9. Cavia porcellus cpo-miR-19b-3p
  10. Cervus elaphus cel-miR-19b
  11. Chrysemys picta bellii Cpi-Mir-19-P2a_3p (mature (guide))
  12. Columba livia cli-miR-19b-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19b-3p
  14. Danio rerio dre-miR-19b-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
  16. Eptatretus burgeri Ebu-Mir-19-P2e_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-19b
  18. Gadus morhua gmo-miR-19b-3p
  19. Gallus gallus (chicken) gga-miR-19b-3p
  20. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19b (MIR19B-2)
  22. Gorilla gorilla ggo-miR-19b
  23. Homo sapiens hsa-miR-19b-3p
  24. Lagothrix lagotricha lla-miR-19b
  25. Latimeria chalumnae Lch-Mir-19-P2c_3p (mature (guide))
  26. Lemur catta lca-miR-19b
  27. Lepisosteus oculatus (spotted gar) Loc-Mir-19-P2a_3p (mature (guide))
  28. Macaca mulatta mml-miR-19b
  29. Macaca nemestrina mne-miR-19b
  30. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
  31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19b-3p
  32. Monopterus albus Mal-Mir-19-P2a1_3p (mature (guide))
  33. Mus musculus mmu-miR-19b-3p
  34. Ophiophagus hannah oha-miR-19b-3p
  35. Ornithorhynchus anatinus oan-miR-19b-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
  37. Ovis aries (sheep) oar-miR-19b
  38. Pan paniscus ppa-miR-19b
  39. Pan troglodytes (chimpanzee) ptr-miR-19b
  40. Petromyzon marinus (sea lamprey) pma-miR-19b-3p
  41. Pongo pygmaeus ppy-miR-19b
  42. Pteropus alecto (black flying fox) pal-miR-19-3p
  43. Python bivittatus Pbv-Mir-19-P2c_3p (mature (guide))
  44. Rattus norvegicus rno-miR-19b-3p
  45. Saguinus labiatus sla-miR-19b
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P2c_3p (mature (guide))
  47. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2c_3p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-19-P2c_3p (mature (guide))
  49. Sus scrofa ssc-miR-19b
  50. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
  51. Takifugu rubripes fru-miR-19b
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-19b
  53. Tor tambroides (Thai mahseer) miR-19b-3p
  54. Tupaia chinensis tch-miR-19b-3p
  55. Xenopus laevis (African clawed frog) xla-miR-19b
  56. Xenopus tropicalis (tropical clawed frog) xtr-miR-19b