Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-19b URS000013D17D_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCCAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 111 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-19-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P2c_3p (mature (guide))
  3. Ateles geoffroyi age-miR-19b
  4. Bos taurus bta-miR-19b
  5. Callithrix jacchus cja-miR-19b
  6. Callorhinchus milii Cmi-Mir-19-P2c_3p (mature (guide))
  7. Canis lupus familiaris (dog) Cfa-Mir-19-P2c_3p (mature (guide))
  8. Capra hircus chi-miR-19b-3p
  9. Cavia porcellus cpo-miR-19b-3p
  10. Cervus elaphus cel-miR-19b
  11. Chrysemys picta bellii Cpi-Mir-19-P2a_3p (mature (guide))
  12. Columba livia cli-miR-19b-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19b-3p
  14. Danio rerio dre-miR-19b-3p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P2c_3p (mature (guide))
  17. Eptatretus burgeri Ebu-Mir-19-P2e_3p (mature (guide))
  18. Equus caballus (horse) eca-miR-19b
  19. Gadus morhua gmo-miR-19b-3p
  20. Gallus gallus (chicken) gga-miR-19b-3p
  21. Gekko japonicus Gja-Mir-19-P2c_3p (mature (guide))
  22. Gorilla gorilla gorilla ggo-miR-19b (MIR19B-2)
  23. Gorilla gorilla ggo-miR-19b
  24. Homo sapiens hsa-miR-19b-3p
  25. Lagothrix lagotricha lla-miR-19b
  26. Latimeria chalumnae Lch-Mir-19-P2c_3p (mature (guide))
  27. Lemur catta lca-miR-19b
  28. Lepisosteus oculatus (spotted gar) Loc-Mir-19-P2a_3p (mature (guide))
  29. Macaca mulatta mml-miR-19b
  30. Macaca nemestrina mne-miR-19b
  31. Microcaecilia unicolor Mun-Mir-19-P2a_3p (mature (guide))
  32. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19b-3p
  33. Monopterus albus Mal-Mir-19-P2a1_3p (mature (guide))
  34. Mus musculus mmu-miR-19b-3p
  35. Ophiophagus hannah oha-miR-19b-3p
  36. Ornithorhynchus anatinus oan-miR-19b-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
  38. Ovis aries (sheep) oar-miR-19b
  39. Pan paniscus ppa-miR-19b
  40. Pan troglodytes (chimpanzee) ptr-miR-19b
  41. Petromyzon marinus (sea lamprey) pma-miR-19b-3p
  42. Pongo pygmaeus ppy-miR-19b
  43. Pteropus alecto (black flying fox) pal-miR-19-3p
  44. Python bivittatus Pbv-Mir-19-P2c_3p (mature (guide))
  45. Rattus norvegicus rno-miR-19b-3p
  46. Saguinus labiatus sla-miR-19b
  47. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P2c_3p (mature (guide))
  48. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2c_3p (mature (guide))
  49. Sphenodon punctatus (tuatara) Spt-Mir-19-P2c_3p (mature (guide))
  50. Sus scrofa ssc-miR-19b
  51. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
  52. Takifugu rubripes fru-miR-19b
  53. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-19b
  54. Tor tambroides (Thai mahseer) miR-19b-3p
  55. Tupaia chinensis tch-miR-19b-3p
  56. Xenopus tropicalis (tropical clawed frog) xtr-miR-19b
Publications