Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-19b-3p URS000013D17D_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 9 databases (PSICQUIC, TarBase, IntAct, ENA, miRBase, PirBase, LncBase, MirGeneDB, RefSeq). Described in 49 papers. Mus musculus (house mouse) mmu-miR-19b-3p sequence is a product of Mir19b-2, 19b, mmu-miR-19b-3p, mmu-miR-19b, Mir19b-1, miR-19b, miR-19, 19, miR-19b-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (homologous Alu RNA binding protein), 0610007H07Rik, 0610007I11Rik, 0610007L03Rik, 0610008N23Rik, 0610008P16Rik, 0610009F02Rik, 0610009H19Rik, 0610010G05Rik, 0610010H08Rik.

Interactions 13

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-19b-3p interacts with:

Interaction id Participant Synonyms
EBI-21300346 intact:EBI-21300334 EBI-21300334 ENSMUST00000013807.7 mrna_pten-1
URS000013D17D_10090-6 F8VPZ1 F8VPZ1
URS000013D17D_10090-0 F8VPZ1 F8VPZ1
URS000013D17D_10090-1 P04426 P04426
URS000013D17D_10090-7 P04426 P04426
URS000013D17D_10090-8 Q60769 Q60769
URS000013D17D_10090-2 Q60769 Q60769
URS000013D17D_10090-9 Q8BM54 Q8BM54
URS000013D17D_10090-3 Q8BM54 Q8BM54
URS000013D17D_10090-4 Q9CPU7 Q9CPU7
URS000013D17D_10090-10 Q9CPU7 Q9CPU7
URS000013D17D_10090-5 Q9ERH7 Q9ERH7
URS000013D17D_10090-11 Q9ERH7 Q9ERH7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGCAAAUCCAUGCAAAACUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 87 other species

    1. Alligator mississippiensis Ami-Mir-19-P2a_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-19-P2b_3p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-19b
    4. Bos taurus (cattle) bta-miR-19b
    5. Callithrix jacchus cja-miR-19b
    6. Canis lupus familiaris Cfa-Mir-19-P2b_3p (mature (guide))
    7. Capra hircus chi-miR-19b-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-19b-3p
    9. Cervus elaphus (red deer) cel-miR-19b
    10. Chrysemys picta bellii Cpi-Mir-19-P2b_3p (mature (guide))
    11. Columba livia (rock pigeon) cli-miR-19b-3p
    12. Cricetulus griseus cgr-miR-19b-3p
    13. Danio rerio (zebrafish) dre-miR-19b-3p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19b-3p
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P2b_3p (mature (guide))
    16. Equus caballus (horse) eca-miR-19b
    17. Gadus morhua gmo-miR-19b-3p
    18. Gallus gallus (chicken) gga-miR-19b-3p
    19. Gorilla gorilla (western gorilla) ggo-miR-19b
    20. Homo sapiens hsa-miR-19b-3p
    21. Lagothrix lagotricha lla-miR-19b
    22. Lemur catta lca-miR-19b
    23. Macaca mulatta mml-miR-19b
    24. Macaca nemestrina (pig-tailed macaque) mne-miR-19b
    25. Monodelphis domestica mdo-miR-19b-3p
    26. Ophiophagus hannah oha-miR-19b-3p
    27. Ornithorhynchus anatinus oan-miR-19b-3p
    28. Oryctolagus cuniculus (rabbit) ocu-miR-19b-3p
    29. Ovis aries oar-miR-19b
    30. Pan paniscus ppa-miR-19b
    31. Pan troglodytes (chimpanzee) ptr-miR-19b
    32. Petromyzon marinus pma-miR-19b-3p
    33. Pongo pygmaeus ppy-miR-19b
    34. Pteropus alecto pal-miR-19-3p
    35. Rattus norvegicus rno-miR-19b-3p
    36. Saguinus labiatus sla-miR-19b
    37. Sarcophilus harrisii Sha-Mir-19-P2b_3p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P2b_3p (mature (guide))
    39. Sus scrofa ssc-miR-19b
    40. Taeniopygia guttata (zebra finch) tgu-miR-19b-3p
    41. Takifugu rubripes (torafugu) fru-miR-19b
    42. Tetraodon nigroviridis tni-miR-19b
    43. Tor tambroides miR-19b-3p
    44. Tupaia chinensis tch-miR-19b-3p
    45. Xenopus laevis (African clawed frog) xla-miR-19b
    46. Xenopus tropicalis xtr-miR-19b