Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vitis vinifera (wine grape) vvi-miR167d URS000013A25F_29760

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 70 other species

  1. Aegilops tauschii ata-miR167c-5p
  2. Ananas comosus (pineapple) microRNA 167g
  3. Arabidopsis lyrata aly-miR167b-5p
  4. Arabidopsis thaliana ath-miR167b
  5. Asparagus officinalis (garden asparagus) aof-miR167a
  6. Brachypodium distachyon bdi-miR167f
  7. Brassica napus (rape) bna-miR167c
  8. Brassica rapa bra-miR167c
  9. Carica papaya (papaya) cpa-miR167b
  10. Citrus sinensis csi-miR167e-5p
  11. Corchorus capsularis (jute) sRNA CCACVL1_14458
  12. Corchorus olitorius ahy-miR167-
  13. Cucumis melo cme-miR167b
  14. Cynara cardunculus var. scolymus cca-miR167c
  15. Digitalis purpurea (common foxglove) dpr-miR167b
  16. Glycine max (soybean) gma-miR167a
  17. Gossypium hirsutum ghr-miR167a
  18. Helianthus annuus ath-miR167a-5p
  19. Linum usitatissimum (flax) lus-miR167c
  20. Malus domestica (apple) mdm-miR167b
  21. Manihot esculenta mes-miR167c
  22. Medicago truncatula mtr-miR167a
  23. Nicotiana tabacum (common tobacco) nta-miR167d
  24. Oryza sativa Japonica Group microRNA osa-miR167b
  25. Oryza sativa osa-miR167a-5p
  26. Populus tomentosa Pto-miR167d
  27. Populus trichocarpa (black cottonwood) ptc-miR167d
  28. Prunus persica ppe-miR167b
  29. Ricinus communis (castor bean) rco-miR167b
  30. Solanum lycopersicum (tomato) sly-miR167a
  31. Solanum tuberosum stu-miR167c-5p
  32. Sorghum bicolor sbi-miR167a
  33. Theobroma cacao (cacao) tcc-miR167a
  34. Triticum aestivum tae-miR167a
  35. Zea mays zma-miR167d-5p
Publications