Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ricinus communis (castor bean) rco-miR167b URS000013A25F_3988

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Aegilops tauschii ata-miR167a-5p
  2. Ananas comosus (pineapple) microRNA 167g
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR167a-5p
  4. Arabidopsis thaliana (thale cress) ath-miR167b
  5. Asparagus officinalis (garden asparagus) aof-miR167a
  6. Brachypodium distachyon bdi-miR167a
  7. Brassica napus (rape) bna-miR167c
  8. Brassica rapa bra-miR167d
  9. Carica papaya cpa-miR167b
  10. Citrus sinensis csi-miR167e-5p
  11. Corchorus capsularis (jute) sRNA CCACVL1_14458
  12. Corchorus olitorius ahy-miR167-
  13. Cucumis melo cme-miR167b
  14. Cynara cardunculus var. scolymus cca-miR167c
  15. Digitalis purpurea (common foxglove) dpr-miR167b
  16. Glycine max (soybean) gma-miR167b
  17. Gossypium hirsutum (cotton) ghr-miR167a
  18. Helianthus annuus (common sunflower) ath-miR167a-5p
  19. Linum usitatissimum lus-miR167e
  20. Malus domestica mdm-miR167b
  21. Manihot esculenta (cassava) mes-miR167c
  22. Medicago truncatula (barrel medic) mtr-miR167a
  23. Nicotiana tabacum (common tobacco) nta-miR167d
  24. Oryza sativa (Asian cultivated rice) osa-miR167b
  25. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167b
  26. Populus tomentosa Pto-miR167d
  27. Populus trichocarpa ptc-miR167a
  28. Prunus persica (peach) ppe-miR167a
  29. Solanum lycopersicum sly-miR167a
  30. Solanum tuberosum (potato) stu-miR167a-5p
  31. Sorghum bicolor (sorghum) sbi-miR167a
  32. Theobroma cacao tcc-miR167a
  33. Triticum aestivum (bread wheat) tae-miR167a
  34. Vitis vinifera vvi-miR167b
  35. Zea mays (maize) zma-miR167c-5p
Publications