Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR167a-5p URS000013A25F_59689

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Aegilops tauschii ata-miR167a-5p
  2. Ananas comosus (pineapple) microRNA 167g
  3. Arabidopsis thaliana (thale cress) ath-miR167b
  4. Asparagus officinalis (garden asparagus) aof-miR167a
  5. Brachypodium distachyon bdi-miR167a
  6. Brassica napus (rape) bna-miR167c
  7. Brassica rapa bra-miR167d
  8. Carica papaya cpa-miR167b
  9. Citrus sinensis csi-miR167e-5p
  10. Corchorus capsularis (jute) sRNA CCACVL1_14458
  11. Corchorus olitorius ahy-miR167-
  12. Cucumis melo cme-miR167b
  13. Cynara cardunculus var. scolymus cca-miR167c
  14. Digitalis purpurea (common foxglove) dpr-miR167b
  15. Glycine max (soybean) gma-miR167b
  16. Gossypium hirsutum (cotton) ghr-miR167a
  17. Helianthus annuus (common sunflower) ath-miR167a-5p
  18. Linum usitatissimum lus-miR167e
  19. Malus domestica mdm-miR167b
  20. Manihot esculenta (cassava) mes-miR167c
  21. Medicago truncatula (barrel medic) mtr-miR167a
  22. Nicotiana tabacum (common tobacco) nta-miR167d
  23. Oryza sativa (Asian cultivated rice) osa-miR167b
  24. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167b
  25. Populus tomentosa Pto-miR167d
  26. Populus trichocarpa ptc-miR167a
  27. Prunus persica (peach) ppe-miR167a
  28. Ricinus communis (castor bean) rco-miR167b
  29. Solanum lycopersicum sly-miR167a
  30. Solanum tuberosum (potato) stu-miR167a-5p
  31. Sorghum bicolor (sorghum) sbi-miR167a
  32. Theobroma cacao tcc-miR167a
  33. Triticum aestivum (bread wheat) tae-miR167a
  34. Vitis vinifera vvi-miR167b
  35. Zea mays (maize) zma-miR167c-5p
Publications