Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brachypodium distachyon (stiff brome) bdi-miR167f URS000013A25F_15368

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAGCUGCCAGCAUGAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 70 other species

  1. Aegilops tauschii ata-miR167c-5p
  2. Ananas comosus (pineapple) microRNA 167g
  3. Arabidopsis lyrata aly-miR167b-5p
  4. Arabidopsis thaliana ath-miR167b
  5. Asparagus officinalis (garden asparagus) aof-miR167a
  6. Brassica napus (rape) bna-miR167c
  7. Brassica rapa bra-miR167c
  8. Carica papaya (papaya) cpa-miR167b
  9. Citrus sinensis csi-miR167e-5p
  10. Corchorus capsularis (jute) sRNA CCACVL1_14458
  11. Corchorus olitorius ahy-miR167-
  12. Cucumis melo cme-miR167b
  13. Cynara cardunculus var. scolymus cca-miR167c
  14. Digitalis purpurea (common foxglove) dpr-miR167b
  15. Glycine max (soybean) gma-miR167a
  16. Gossypium hirsutum ghr-miR167a
  17. Helianthus annuus ath-miR167a-5p
  18. Linum usitatissimum (flax) lus-miR167c
  19. Malus domestica (apple) mdm-miR167b
  20. Manihot esculenta mes-miR167c
  21. Medicago truncatula mtr-miR167a
  22. Nicotiana tabacum (common tobacco) nta-miR167d
  23. Oryza sativa Japonica Group microRNA osa-miR167b
  24. Oryza sativa osa-miR167a-5p
  25. Populus tomentosa Pto-miR167d
  26. Populus trichocarpa (black cottonwood) ptc-miR167d
  27. Prunus persica ppe-miR167b
  28. Ricinus communis (castor bean) rco-miR167b
  29. Solanum lycopersicum (tomato) sly-miR167a
  30. Solanum tuberosum stu-miR167c-5p
  31. Sorghum bicolor sbi-miR167a
  32. Theobroma cacao (cacao) tcc-miR167a
  33. Triticum aestivum tae-miR167a
  34. Vitis vinifera vvi-miR167d
  35. Zea mays zma-miR167d-5p
Publications