Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aegilops tauschii ata-miR528-5p URS0000134380_37682

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ata-miR528-5p: ata-mir528-5p is a microRNA that has been studied in various contexts. In DBA Aurora, ata-mir528-5p was found to be significantly down-regulated under different stresses at different developmental stages [PMC7504575]. It was also down-regulated in DBA Aurora under heat stress and waterlogging, but not in the L6 variety [PMC7504575]. ata-mir528-5p, along with other miRNAs, was found to be highly expressed during the middle stages of development in durum wheat [PMC7045451]. It was predicted to target genes involved in transport, as well as carbohydrate metabolism and signal transduction [PMC7045451]. ata-mir528-5p has been shown to promote redox homeostasis by targeting genes such as the F-box protein and Cu Zn superoxide dismutase (Cu Zn SOD) under stress conditions [PMC9433978]. In addition, ata-mir528-5p has been found to be significantly down-regulated in leaf tissue under heat stress conditions compared to control conditions [PMC8197280]. The target of ata-mir528-5p, an F-box protein gene, showed higher expression levels under reoccurring stress induced by parental heat stress [PMC8197280]. Similarly, osa-miR398a_L+1R-1 expression was also significantly lower under heat stress conditions compared to control conditions [PMC8197280]. Overall, these findings highlight the role of ata-mir528-5p in response to various stresses and its potential involvement in redox homeostasis and gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGGGGCAUGCAGAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ananas comosus microRNA 528a
  2. Brachypodium distachyon (stiff brome) bdi-miR528-5p
  3. Oryza sativa (Asian cultivated rice) osa-miR528-5p
  4. Oryza sativa Japonica Group microRNA osa-miR528-5p
  5. Saccharum sp. ssp-miR528
  6. Sorghum bicolor (sorghum) sbi-miR528
  7. Vriesea carinata vca-miR528-5p
  8. Zea mays (maize) zma-miR528a-5p
Publications