Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR528-5p URS0000134380_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR528-5p: Osa-mir528-5p is a mature miRNA that is up-regulated by Cd treatment [PMC7003353]. In a study of rice inflorescence small RNA libraries, a total of 183 mature miRNAs from 122 non-conserved families were identified [PMC5647096]. Among these miRNAs, over 156 had an expression level of TPM<10, 19 had TPM values between 10 and 100, and 7 had TPM values between 100 and 1000 [PMC5647096]. Interestingly, only osa-mir528-5p had a TPM value greater than 1000 [PMC5647096]. This suggests that osa-mir528-5p is highly expressed compared to other miRNAs in rice inflorescence. The up-regulation of osa-mir528-5p by Cd treatment indicates its potential role in response to cadmium stress [PMC7003353]. The specific function of osa-mir528-5p in this context is not mentioned in the given information. However, further research may provide insights into its role in the response to cadmium stress and its potential implications for rice plants.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGGGGCAUGCAGAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Aegilops tauschii ata-miR528-5p
  2. Ananas comosus microRNA 528a
  3. Brachypodium distachyon (stiff brome) bdi-miR528-5p
  4. Oryza sativa Japonica Group microRNA osa-miR528-5p
  5. Saccharum sp. ssp-miR528
  6. Sorghum bicolor (sorghum) sbi-miR528
  7. Vriesea carinata vca-miR528-5p
  8. Zea mays (maize) zma-miR528a-5p
Publications