Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-101-3p URS00001230A0_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (LncBase, IntAct, miRBase, ENA, MalaCards, RefSeq, TarBase, GeneCards, PSICQUIC). Described in 106 papers. Homo sapiens (human) hsa-miR-101-3p sequence is a product of MIR101-2, MIR101-1, hsa-miR-101-3p, miR-101, hsa-miR-101, miR-101-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8U, 101F6, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 156DAG, 182-FIP, 2310047H23Rik, 2B28, 2C4D.

Interactions 22

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-101-3p interacts with:

Interaction id Participant Synonyms
EBI-17173497 intact:EBI-17173468 EBI-17173468 ENST00000369026.2 mrna_mcl1
EBI-20586491 intact:EBI-17173468 EBI-17173468 ENST00000369026.2 mrna_mcl1
EBI-25464198 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25464244 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
URS00001230A0_9606-6 O60603 O60603
URS00001230A0_9606-8 O60603 O60603
URS00001230A0_9606-9 P05067 P05067
URS00001230A0_9606-7 P05067 P05067
URS00001230A0_9606-10 P33151 P33151
URS00001230A0_9606-11 P33151 P33151
URS00001230A0_9606-0 P33151 P33151
URS00001230A0_9606-1 P33151 P33151
URS00001230A0_9606-12 Q07820 Q07820
URS00001230A0_9606-2 Q07820 Q07820
URS00001230A0_9606-13 Q13546 Q13546
URS00001230A0_9606-3 Q13546 Q13546
URS00001230A0_9606-14 Q13618 Q13618
URS00001230A0_9606-4 Q13618 Q13618
URS00001230A0_9606-5 Q96S59 Q96S59
URS00001230A0_9606-15 Q96S59 Q96S59
EBI-17173682 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human
EBI-17173627 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACAGUACUGUGAUAACUGAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos taurus (cattle) bta-miR-101
    2. Callithrix jacchus cja-miR-101-2
    3. Columba livia (rock pigeon) cli-miR-101-3p
    4. Equus caballus (horse) eca-miR-101
    5. Mus musculus (house mouse) mmu-miR-101a-3p
    6. Pongo pygmaeus ppy-miR-101
    7. Rattus norvegicus rno-miR-101a-3p
    8. Sus scrofa ssc-miR-101
    9. Xenopus laevis (African clawed frog) xla-miR-101a
    10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2499796