Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-101a-3p URS00001230A0_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-101a: mmu-mir-101a is a specific miRNA that is differentially expressed during implantation in the mouse uterus and is coordinated with the expression of cyclooxygenase-2 (Cox-2), a gene critical for implantation [PMC3462109]. It has been found that mmu-mir-101a and mmu-miR-199a* are spatiotemporally expressed in the mouse uterus during implantation, along with the expression of Cox-2 [PMC3692437]. These two uterine miRNAs, mmu-mir-101a and mmu-miR-199a*, have been shown to posttranscriptionally regulate a gene critical for implantation [PMC5496128]. In a study on LPS-activated RAW264.7 macrophages, it was analyzed that miR-101 affects the protein level of MKP-1 when transfected with dsRNA mimic or ssRNA inhibitor for mmu-mir-101a [PMC4011752]. The dsRNA mimic for mmu-mir-101a has a sense strand of 5′-UAC AGU ACU GUG AUA ACU GAA -3′ and an antisense strand of 5′ -CAG UUA UCA CAG UAC UGU AUU -3′ [PMC4011752]. The ssRNA inhibitor against mmu-mir-101a has a strand of 5′ -UUC AGU UAU CAC AGU ACU GUA -3′ [PMC4011752]. In mice, it was found that mmu-mir-101a and mmu-miR3653p were downregulated based on miRNA expression profile analysis using microarray analysis [PMC8914318]. The functional significance of uterine expression of mmu-mir 101-a and mmu-miR-199a and their regulation of PTGS2 in a murine embryo implantation model has been demonstrated [PMC3168490]. mmu-mir-101a and mmu-miR-199a have been shown to post-transcriptionally regulate the mRNA expression of cyclooxygenase-2, which is critical for embryonic implantation [PMC5364990]. Additionally, mmu-mir-101a has been found to target the transforming growth factor-beta gene (TGF-beta) and its receptor gene [PMC9198802]. A probe containing a hybridization solution for mmu-mir-101a was added at a concentration of 8 ng/μL during hybridization at 37 °C overnight [PMC7557009].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUACUGUGAUAACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-101
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-101-2
  3. Columba livia cli-miR-101-3p
  4. Equus caballus (horse) eca-miR-101
  5. Homo sapiens (human) hsa-miR-101-3p
  6. Pongo pygmaeus ppy-miR-101
  7. Rattus norvegicus (Norway rat) rno-miR-101a-3p
  8. Sus scrofa ssc-miR-101
  9. Xenopus laevis xla-miR-101a
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2499796
Publications