Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-101 URS00001230A0_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-101: ssc-mir-101 is a microRNA that has been identified as a potential target gene in various studies. It has been found to be down-regulated in castrated male pigs, along with other microRNAs such as ssc-miR-185, ssc-F3-C29, ssc-miR-152, and ssc-miR-150 [PMC3901342]. Additionally, ssc-mir-101 has been predicted to target the gene MAPK1 along with other microRNAs such as ssc-miR-204, ssc-miR-129-5p, ssc-miR-194a, ssc-miR-181a, and ssc-miR-130a [PMC3901342]. In a study comparing different liver samples, it was found that ssc-mir-101 was overexpressed in L samples while other microRNAs such as ssc-miR-92a and sccmi-R181d were overexpressed in H samples [PMC5155628]. Furthermore, the expression levels of four miRNAs including sccmi-R92a and ssccmi-R181d were experimentally validated due to their role in reproductive-related pathways [PMC5155628]. In deep sequencing data of two pig breeds, it was found that ssccmi-R101 was one of the highly expressed miRNAs along with others such as ssccmi-R148a3p and ssccmi-R122 [PMC6718901]. Additionally, ssccmi-R101 has been identified as a key miRNA along with others like ssccmi-R210 and ssccmi-R206 [PMC8529057]. It has also been suggested that FOS may be a potential target of ssccmir101 based on its downregulation in the study [PMC4646468]. Furthermore, ssccmir101 has been found to be downregulated in the TP relative to the YP, along with other miRNAs [PMC4646468]. Finally, in a study on miRNA expression levels, ssccmi-R101 was used for normalization along with other miRNAs [PMC5819844].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUACUGUGAUAACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-101
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-101-2
  3. Columba livia cli-miR-101-3p
  4. Equus caballus (horse) eca-miR-101
  5. Homo sapiens (human) hsa-miR-101-3p
  6. Mus musculus (house mouse) mmu-miR-101a-3p
  7. Pongo pygmaeus ppy-miR-101
  8. Rattus norvegicus (Norway rat) rno-miR-101a-3p
  9. Xenopus laevis xla-miR-101a
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2499796
Publications