Pan paniscus (pygmy chimpanzee) ppa-miR-660 URS0000116A70_9597

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 25 other species
• 6 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UACCCAUUGCAUAUCGGAGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

1. Callithrix jacchus cja-miR-660
2. Canis lupus familiaris cfa-miR-660
3. Daubentonia madagascariensis dma-miR-660
4. Equus caballus (horse) eca-miR-660
5. Gorilla gorilla gorilla ggo-miR-660 (MIR660)
6. Gorilla gorilla ggo-miR-660
7. Homo sapiens hsa-miR-660-5p
8. Macaca mulatta (Rhesus monkey) mml-miR-660-5p
9. Pan troglodytes (chimpanzee) ptr-miR-660
10. Papio hamadryas pha-miR-660
11. Pongo pygmaeus (Bornean orangutan) ppy-miR-660
12. Pteropus alecto pal-miR-660-5p
13. Sus scrofa (pig) ssc-miR-660

Publications Download

• FASTA
• JSON