Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daubentonia madagascariensis (aye-aye) dma-miR-660 URS0000116A70_31869

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCAUUGCAUAUCGGAGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-660
  2. Canis lupus familiaris (dog) cfa-miR-660
  3. Equus caballus eca-miR-660
  4. Gorilla gorilla gorilla ggo-miR-660 (MIR660)
  5. Gorilla gorilla (western gorilla) ggo-miR-660
  6. Homo sapiens hsa-miR-660-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-660-5p
  8. Pan paniscus (pygmy chimpanzee) ppa-miR-660
  9. Pan troglodytes ptr-miR-660
  10. Papio hamadryas pha-miR-660
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-660
  12. Pteropus alecto (black flying fox) pal-miR-660-5p
  13. Sus scrofa ssc-miR-660