Pongo pygmaeus (Bornean orangutan) ppy-miR-660

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-660 URS0000116A70_9600

22 nucleotides
1 database (miRBase)
Found in 13 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UACCCAUUGCAUAUCGGAGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Callithrix jacchus cja-miR-660
Canis lupus familiaris (dog) cfa-miR-660
Daubentonia madagascariensis dma-miR-660
Equus caballus eca-miR-660
Gorilla gorilla gorilla ggo-miR-660 (MIR660)
Gorilla gorilla (western gorilla) ggo-miR-660
Homo sapiens hsa-miR-660-5p
Macaca mulatta (Rhesus monkey) mml-miR-660-5p
Pan paniscus (pygmy chimpanzee) ppa-miR-660
Pan troglodytes ptr-miR-660
Papio hamadryas pha-miR-660
Pteropus alecto (black flying fox) pal-miR-660-5p
Sus scrofa ssc-miR-660