v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-135a-5p URS00000DF6D0_9031

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGGCUUUUUAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 101 other species

  1. Alligator mississippiensis Ami-Mir-135-P2_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-135-5p
  3. Ateles geoffroyi age-miR-135
  4. Bos taurus bta-miR-135a
  5. Callithrix jacchus cja-miR-135
  6. Callorhinchus milii Cmi-Mir-135-P2_5p (mature (guide))
  7. Canis lupus familiaris cfa-miR-135a-5p
  8. Capra hircus chi-miR-135a
  9. Cavia porcellus (domestic guinea pig) cpo-miR-135a-5p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-135-P2_5p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-135-5p
  12. Danio rerio dre-miR-135a
  13. Dasypus novemcinctus dno-miR-135a-5p
  14. Echinops telfairi Ete-Mir-135-P2_5p (mature (guide))
  15. Eptatretus burgeri (inshore hagfish) Ebu-Mir-135-P10_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-135a
  17. Gadus morhua Gmo-Mir-135-P2a_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-135-P2_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-135a (MIR135A)
  20. Gorilla gorilla ggo-miR-135a
  21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-135c-5p
  22. Homo sapiens hsa-miR-135a-5p
  23. Ictalurus punctatus (channel catfish) ipu-miR-135a
  24. Lagothrix lagotricha (brown woolly monkey) lla-miR-135
  25. Latimeria chalumnae Lch-Mir-135-P2_5p (mature (guide))
  26. Macaca mulatta mml-miR-135a-5p
  27. Maylandia zebra (zebra mbuna) mze-miR-135c
  28. Microcaecilia unicolor Mun-Mir-135-P2_5p (mature (guide))
  29. Monodelphis domestica mdo-miR-135a-5p
  30. Monopterus albus (swamp eel) Mal-Mir-135-P2a_5p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-135a-5p
  32. Neolamprologus brichardi nbr-miR-135c-5p
  33. Ophiophagus hannah oha-miR-135-5p
  34. Oreochromis niloticus (Nile tilapia) oni-miR-135c
  35. Ornithorhynchus anatinus oan-miR-135b-5p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-135a-5p
  37. Pan paniscus (pygmy chimpanzee) ppa-miR-135
  38. Pan troglodytes ptr-miR-135a
  39. Petromyzon marinus (sea lamprey) pma-miR-135a-5p
  40. Pongo pygmaeus ppy-miR-135a
  41. Pundamilia nyererei pny-miR-135c-5p
  42. Python bivittatus pbv-miR-135-5p
  43. Rattus norvegicus rno-miR-135a-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P2_5p (mature (guide))
  45. Scyliorhinus torazame (cloudy catshark) Sto-Mir-135-P2_5p (mature (guide))
  46. Sphenodon punctatus (tuatara) Spt-Mir-135-P2_5p (mature (guide))
  47. Sus scrofa ssc-miR-135
  48. Taeniopygia guttata tgu-miR-135a-5p
  49. Tupaia chinensis tch-miR-135a-5p
  50. Xenopus laevis Xla-Mir-135-P2d_5p (mature (co-guide))
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-135
 Publications