Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-135c URS00000DF6D0_106582

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCUUUUUAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-135-P2_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-135-5p
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-135
  4. Bos taurus (cattle) bta-miR-135a
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-135
  6. Callorhinchus milii (elephant shark) Cmi-Mir-135-P2_5p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-135a-5p
  8. Capra hircus chi-miR-135a
  9. Cavia porcellus (domestic guinea pig) cpo-miR-135a-5p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-135-P2_5p (mature (guide))
  11. Columba livia cli-miR-135-5p
  12. Danio rerio dre-miR-135a
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-135a-5p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P2_5p (mature (guide))
  15. Eptatretus burgeri Ebu-Mir-135-P10_5p (mature (guide))
  16. Equus caballus eca-miR-135a
  17. Gadus morhua (Atlantic cod) Gmo-Mir-135-P2a_5p (mature (guide))
  18. Gallus gallus gga-miR-135a-5p
  19. Gekko japonicus Gja-Mir-135-P2_5p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-135a (MIR135A)
  21. Gorilla gorilla (western gorilla) ggo-miR-135a
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-135c-5p
  23. Homo sapiens hsa-miR-135a-5p
  24. Ictalurus punctatus ipu-miR-135a
  25. Lagothrix lagotricha (brown woolly monkey) lla-miR-135
  26. Latimeria chalumnae Lch-Mir-135-P2_5p (mature (guide))
  27. Macaca mulatta mml-miR-135a-5p
  28. Microcaecilia unicolor Mun-Mir-135-P2_5p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-135a-5p
  30. Monopterus albus Mal-Mir-135-P2a_5p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-135a-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-135c-5p
  33. Ophiophagus hannah (king cobra) oha-miR-135-5p
  34. Oreochromis niloticus (Nile tilapia) oni-miR-135c
  35. Ornithorhynchus anatinus oan-miR-135b-5p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-135a-5p
  37. Pan paniscus ppa-miR-135
  38. Pan troglodytes ptr-miR-135a
  39. Petromyzon marinus pma-miR-135a-5p
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-135a
  41. Pundamilia nyererei pny-miR-135c-5p
  42. Python bivittatus pbv-miR-135-5p
  43. Rattus norvegicus rno-miR-135a-5p
  44. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P2_5p (mature (guide))
  45. Scyliorhinus torazame (cloudy catshark) Sto-Mir-135-P2_5p (mature (guide))
  46. Sphenodon punctatus Spt-Mir-135-P2_5p (mature (guide))
  47. Sus scrofa (pig) ssc-miR-135
  48. Taeniopygia guttata (zebra finch) tgu-miR-135a-5p
  49. Tupaia chinensis tch-miR-135a-5p
  50. Xenopus laevis Xla-Mir-135-P2d_5p (mature (co-guide))
  51. Xenopus tropicalis xtr-miR-135