Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-135c URS00000DF6D0_8128

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Oreochromis niloticus. Annotated by 1 database (miRBase). Found in the nile tilapia reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAUGGCUUUUUAUUCCUAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 50 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-135-P2_5p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-135-5p
    3. Ateles geoffroyi age-miR-135
    4. Bos taurus bta-miR-135a
    5. Callithrix jacchus cja-miR-135
    6. Callorhinchus milii (elephant shark) Cmi-Mir-135-P2_5p (mature (guide))
    7. Canis lupus familiaris (dog) cfa-miR-135a-5p
    8. Capra hircus chi-miR-135a
    9. Cavia porcellus (domestic guinea pig) cpo-miR-135a-5p
    10. Chrysemys picta bellii Cpi-Mir-135-P2_5p (mature (guide))
    11. Columba livia cli-miR-135-5p
    12. Danio rerio dre-miR-135a
    13. Dasypus novemcinctus dno-miR-135a-5p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P2_5p (mature (guide))
    15. Eptatretus burgeri Ebu-Mir-135-P10_5p (mature (guide))
    16. Equus caballus eca-miR-135a
    17. Gadus morhua Gmo-Mir-135-P2a_5p (mature (guide))
    18. Gallus gallus gga-miR-135a-5p
    19. Gekko japonicus Gja-Mir-135-P2_5p (mature (guide))
    20. Gorilla gorilla ggo-miR-135a
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-135c-5p
    22. Homo sapiens (human) hsa-miR-135a-5p
    23. Ictalurus punctatus (channel catfish) ipu-miR-135a
    24. Lagothrix lagotricha (brown woolly monkey) lla-miR-135
    25. Latimeria chalumnae (coelacanth) Lch-Mir-135-P2_5p (mature (guide))
    26. Macaca mulatta mml-miR-135a-5p
    27. Maylandia zebra (zebra mbuna) mze-miR-135c
    28. Microcaecilia unicolor Mun-Mir-135-P2_5p (mature (guide))
    29. Monodelphis domestica mdo-miR-135a-5p
    30. Monopterus albus Mal-Mir-135-P2a_5p (mature (guide))
    31. Mus musculus (house mouse) mmu-miR-135a-5p
    32. Neolamprologus brichardi nbr-miR-135c-5p
    33. Ophiophagus hannah oha-miR-135-5p
    34. Ornithorhynchus anatinus (platypus) oan-miR-135b-5p
    35. Oryctolagus cuniculus (rabbit) ocu-miR-135a-5p
    36. Pan paniscus ppa-miR-135
    37. Pan troglodytes (chimpanzee) ptr-miR-135a
    38. Petromyzon marinus (sea lamprey) pma-miR-135a-5p
    39. Pongo pygmaeus (Bornean orangutan) ppy-miR-135a
    40. Pundamilia nyererei pny-miR-135c-5p
    41. Python bivittatus (Burmese python) pbv-miR-135-5p
    42. Rattus norvegicus (Norway rat) rno-miR-135a-5p
    43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P2_5p (mature (guide))
    44. Scyliorhinus torazame Sto-Mir-135-P2_5p (mature (guide))
    45. Sphenodon punctatus (tuatara) Spt-Mir-135-P2_5p (mature (guide))
    46. Sus scrofa ssc-miR-135
    47. Taeniopygia guttata tgu-miR-135b
    48. Tupaia chinensis tch-miR-135a-5p
    49. Xenopus laevis Xla-Mir-135-P2d_5p (mature (co-guide))
    50. Xenopus tropicalis (tropical clawed frog) xtr-miR-135