Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-135a URS00000DF6D0_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (miRBase, MirGeneDB, RefSeq, ENA). Described in 8 papers. Danio rerio (zebrafish) dre-miR-135a sequence is a product of miR-135, dre-miR-135a, mir135a, miR-135a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGGCUUUUUAUUCCUAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-135-P2_5p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-135-5p
    3. Ateles geoffroyi age-miR-135
    4. Bos taurus (cattle) bta-miR-135a
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-135
    6. Callorhinchus milii eshark_mir-135_4
    7. Canis lupus familiaris cfa-miR-135a-5p
    8. Capra hircus chi-miR-135a
    9. Cavia porcellus (domestic guinea pig) cpo-miR-135a-5p
    10. Chrysemys picta bellii Cpi-Mir-135-P2_5p (mature (guide))
    11. Columba livia cli-miR-135-5p
    12. Dasypus novemcinctus dno-miR-135a-5p
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-135-P2_5p (mature (guide))
    14. Equus caballus eca-miR-135a
    15. Gallus gallus (chicken) gga-miR-135a-5p
    16. Gorilla gorilla ggo-miR-135a
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-135c-5p
    18. Homo sapiens hsa-miR-135a-5p
    19. Ictalurus punctatus ipu-miR-135a
    20. Lagothrix lagotricha lla-miR-135
    21. Macaca mulatta mml-miR-135a-5p
    22. Maylandia zebra (zebra mbuna) mze-miR-135c
    23. Monodelphis domestica mdo-miR-135a-5p
    24. Mus musculus mmu-miR-135a-5p
    25. Neolamprologus brichardi nbr-miR-135c-5p
    26. Ophiophagus hannah oha-miR-135-5p
    27. Oreochromis niloticus oni-miR-135c
    28. Ornithorhynchus anatinus oan-miR-135b-5p
    29. Oryctolagus cuniculus ocu-miR-135a-5p
    30. Pan paniscus (pygmy chimpanzee) ppa-miR-135
    31. Pan troglodytes ptr-miR-135a
    32. Petromyzon marinus (sea lamprey) pma-miR-135a-5p
    33. Pongo pygmaeus ppy-miR-135a
    34. Pundamilia nyererei pny-miR-135c-5p
    35. Python bivittatus (Burmese python) pbv-miR-135-5p
    36. Rattus norvegicus (Norway rat) rno-miR-135a-5p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P2_5p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-135-P2_5p (mature (guide))
    39. Sus scrofa (pig) ssc-miR-135
    40. Taeniopygia guttata tgu-miR-135a-5p
    41. Tupaia chinensis tch-miR-135a-5p
    42. Xenopus tropicalis (tropical clawed frog) xtr-miR-135