Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-188-P1_5p (mature (guide)) URS00000DE63C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-188: Hsa-mir-188 is a cancer-related miRNA that has been associated with acute myeloid leukemia [PMC5558674]. High expression levels of hsa-mir-188 have been found to indicate a shorter patient survival time [PMC9019458]. The role of hsa-mir-188 in ovarian cancer remains undetermined [PMC5945511]. Hsa-miR-188 has been shown to inhibit the proliferation, migration, and invasion of glioma by suppressing the expression of IGF2BP2 [PMC7946859]. The target genes of hsa-miR-3677 and hsa-miR-188 have been predicted using mirDB and WGCNA [PMC8298461]. A precursor expression vector for hsa-miR-188 has been constructed for further study [PMC7844764]. HSA-MIR 188 is part of a cluster on human chromosome X that includes other genes such as HN 11, HP 77, HN 12, and HN 13 [PMC1315341]. The upregulation of all seven miRNA members in the hsa-MIR 188 cluster has been observed in certain conditions [PMC4665306]. MicroRNA present in autism-associated CNVs may play a role in disease phenotype determination or contribution to autism spectrum disorders [PMC3581547].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCCCUUGCAUGGUGGAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-188
  2. Canis lupus familiaris (dog) cfa-miR-188
  3. Cavia porcellus (domestic guinea pig) Cpo-Mir-188-P1_5p (mature (co-guide))
  4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-188-P1_5p (mature (guide))
  5. Eptesicus fuscus efu-miR-188
  6. Macaca mulatta mml-miR-188-5p
  7. Macaca nemestrina mne-miR-188
  8. Mus musculus (house mouse) Mmu-Mir-188-P1_5p (mature (guide))
  9. Oryctolagus cuniculus (rabbit) Ocu-Mir-188-P1_5p (mature (guide))
  10. Pan paniscus ppa-miR-188
  11. Pan troglodytes ptr-miR-188
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-188
  13. Sus scrofa (pig) ssc-mir11
  14. Tupaia chinensis tch-miR-188-5p
Publications