v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-188-P1_5p (mature (guide)) URS00000DE63C_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUCCCUUGCAUGGUGGAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-188
  2. Canis lupus familiaris (dog) cfa-miR-188
  3. Cavia porcellus (domestic guinea pig) Cpo-Mir-188-P1_5p (mature (co-guide))
  4. Eptesicus fuscus efu-miR-188
  5. Homo sapiens Hsa-Mir-188-P1_5p (mature (guide))
  6. Macaca mulatta mml-miR-188-5p
  7. Macaca nemestrina mne-miR-188
  8. Mus musculus (house mouse) Mmu-Mir-188-P1_5p (mature (guide))
  9. Oryctolagus cuniculus (rabbit) Ocu-Mir-188-P1_5p (mature (guide))
  10. Pan paniscus ppa-miR-188
  11. Pan troglodytes ptr-miR-188
  12. Pongo pygmaeus (Bornean orangutan) ppy-miR-188
  13. Sus scrofa (pig) ssc-mir11
  14. Tupaia chinensis tch-miR-188-5p