v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-188 URS00000DE63C_9598

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CAUCCCUUGCAUGGUGGAGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Bos taurus bta-miR-188
    2. Canis lupus familiaris (dog) cfa-miR-188
    3. Cavia porcellus Cpo-Mir-188-P1_5p (mature (co-guide))
    4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-188-P1_5p (mature (guide))
    5. Eptesicus fuscus efu-miR-188
    6. Homo sapiens Hsa-Mir-188-P1_5p (mature (guide))
    7. Macaca mulatta mml-miR-188-5p
    8. Macaca nemestrina (pig-tailed macaque) mne-miR-188
    9. Mus musculus (house mouse) Mmu-Mir-188-P1_5p (mature (guide))
    10. Oryctolagus cuniculus Ocu-Mir-188-P1_5p (mature (guide))
    11. Pan paniscus ppa-miR-188
    12. Pongo pygmaeus ppy-miR-188
    13. Sus scrofa (pig) ssc-mir11
    14. Tupaia chinensis tch-miR-188-5p
     Publications