Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-196a URS00000DA6A7_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-196a: Bta-mir-196a is a microRNA that has been studied in various contexts. It has been found to have hypomethylated putative transcription start sites (TSS) in two loci [PMC6691986]. Bta-mir-196a, along with other microRNAs such as bta-miR-146b, bta-miR-26b, and bta-miR-30d, has been implicated in the regulation of muscle fatty acid composition [PMC6637853]. It has also been reported to have a higher expression level in cattle with higher amounts of intramuscular fat [PMC6637853]. Bta-mir-196a was detected at day 3 but disappeared at day 7 of the estrous cycle [PMC4156418]. In the context of sperm, bta-mir-196a was found to be enriched in Y sperm compared to X sperm [PMC7505075]. Bta-mir-196a has also been identified in bovine milk and colostrum [PMC8787201]. In yak testes development, bta-mir-196a is among the microRNAs that could be involved [PMC9940382]. It is differentially expressed between fresh and frozen sperm and is also differentially expressed during S. aureus infection and Crohn's disease associated with MAP infection [PMC7214931] [PMC8568169]. Additionally, its expression has been verified in various tissues such as the hypothalamus, pituitary gland, and mammary gland using RT-qPCR [PMC9821774]. Overall, there are 13 bovine homologs of bta-mir-196a that have been identified. Two of them are read in reverse direction while eleven are forward stranded [PMC9459146].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAUGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 108 other species

  1. Alligator mississippiensis Ami-Mir-196-P3_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-196-P1_5p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-196
  4. Callorhinchus milii Cmi-Mir-196-P4_5p (mature (guide))
  5. Canis lupus familiaris (dog) cfa-miR-196a
  6. Cavia porcellus (domestic guinea pig) cpo-miR-196a-5p
  7. Chiloscyllium plagiosum microRNA cpl-miR-196a
  8. Chrysemys picta bellii Cpi-Mir-196-P3_5p (mature (guide))
  9. Chrysemys picta cpi-miR-196-5p
  10. Columba livia (rock pigeon) cli-miR-196-5p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-196a-5p
  12. Cyprinus carpio (common carp) ccr-miR-196a
  13. Danio rerio (zebrafish) dre-miR-196a-5p
  14. Daubentonia madagascariensis (aye-aye) dma-miR-196
  15. Eptatretus burgeri (inshore hagfish) Ebu-Mir-196-P5_5p (mature (guide))
  16. Equus caballus eca-miR-196a
  17. Gadus morhua (Atlantic cod) gmo-miR-196a-5p
  18. Gallus gallus Gga-Mir-196-P3_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-196-P1_5p (mature (guide))
  20. Gorilla gorilla (western gorilla) microRNA mir-196-2
  21. Haplochromis burtoni abu-miR-196a
  22. Homo sapiens (human) hsa-miR-196a-5p
  23. Lagothrix lagotricha lla-miR-196
  24. Latimeria chalumnae (coelacanth) Lch-Mir-196-P3_5p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-196-P3_5p (mature (guide))
  26. Lethenteron camtschaticum (Arctic lamprey) miR-196
  27. Macaca mulatta (Rhesus monkey) Mml-Mir-196-P3_5p (mature (guide))
  28. Maylandia zebra (zebra mbuna) mze-miR-196a
  29. Microcaecilia unicolor Mun-Mir-196-P1_5p (mature (guide))
  30. Monopterus albus (swamp eel) Mal-Mir-196-P4a_5p (mature (guide))
  31. Mus musculus mmu-miR-196a-5p
  32. Neolamprologus brichardi nbr-miR-196a
  33. Ophiophagus hannah (king cobra) oha-miR-196b-5p
  34. Oreochromis niloticus (Nile tilapia) oni-miR-196a
  35. Ornithorhynchus anatinus (platypus) oan-miR-196a-5p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-196a-5p
  37. Otolemur garnettii oga-miR-196a
  38. Pan paniscus ppa-miR-196
  39. Pan troglodytes ptr-miR-196a
  40. Papio hamadryas (hamadryas baboon) pha-miR-196a
  41. Petromyzon marinus (sea lamprey) pma-miR-196a-5p
  42. Pongo pygmaeus ppy-miR-196-2
  43. Pundamilia nyererei pny-miR-196a
  44. Rattus norvegicus rno-miR-196a-5p
  45. Salmo salar ssa-miR-196a-5p
  46. Scyliorhinus torazame (cloudy catshark) Sto-Mir-196-P3_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-196-P1_5p (mature (guide))
  48. Sus scrofa ssc-miR-196a
  49. Taeniopygia guttata Tgu-Mir-196-P1_5p (mature (guide))
  50. Takifugu rubripes (torafugu) fru-miR-196a
  51. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196a
  52. Tor tambroides (Thai mahseer) miR-196a-5p
  53. Xenopus laevis (African clawed frog) Xla-Mir-196-P4c-v1_5p (mature (guide))
  54. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-196-P4_5p (mature (guide))
Publications