Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila pseudoobscura dps-miR-929-5p URS00000D9090_7237

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAUUGACUCUAGUAGGGAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Blattella germanica (German cockroach) Bge-Mir-929-v1_5p (mature (guide))
  2. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-929
  3. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-929
  4. Diachasmimorpha longicaudata Dlo-Mir-929-v2_5p (mature (guide))
  5. Drosophila ananassae Dan-Mir-929_5p (mature (guide))
  6. Drosophila melanogaster (fruit fly) dme-miR-929-5p
  7. Drosophila mojavensis Dmo-Mir-929_5p (mature (guide))
  8. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0331022_df_nrg
  9. Drosophila simulans dsi-miR-929-5p
  10. Drosophila yakuba Dya-Mir-929_5p (mature (guide))
  11. Glossina pallidipes (tsetse fly) Gpa-Mir-929_5p (mature (co-guide))
  12. Heliconius melpomene hme-miR-929
  13. Polistes canadensis pca-miR-929-5p
Relationships

Molecular Relationships