v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Blattella germanica (German cockroach) Bge-Mir-929-v1_5p (mature (guide)) URS00000D9090_6973

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAUUGACUCUAGUAGGGAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-929
  2. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-929
  3. Drosophila ananassae Dan-Mir-929_5p (mature (guide))
  4. Drosophila melanogaster (fruit fly) dme-miR-929-5p
  5. Drosophila mojavensis Dmo-Mir-929_5p (mature (guide))
  6. Drosophila pseudoobscura dps-miR-929-5p
  7. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0331022_df_nrg
  8. Drosophila simulans dsi-miR-929-5p
  9. Drosophila yakuba Dya-Mir-929_5p (mature (guide))
  10. Heliconius melpomene hme-miR-929
  11. Polistes canadensis pca-miR-929-5p