Cochliomyia hominivorax (primary screw-worm) mature cho-miR-929

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-929 URS00000D9090_115425

22 nucleotides
1 database (ENA)
Found in 13 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAAUUGACUCUAGUAGGGAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

Blattella germanica (German cockroach) Bge-Mir-929-v1_5p (mature (guide))
Cochliomyia macellaria (secondary screw-worm) mature cma-miR-929
Diachasmimorpha longicaudata Dlo-Mir-929-v2_5p (mature (guide))
Drosophila ananassae Dan-Mir-929_5p (mature (guide))
Drosophila melanogaster (fruit fly) dme-miR-929-5p
Drosophila mojavensis Dmo-Mir-929_5p (mature (guide))
Drosophila pseudoobscura dps-miR-929-5p
Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0331022_df_nrg
Drosophila simulans dsi-miR-929-5p
Drosophila yakuba Dya-Mir-929_5p (mature (guide))
Glossina pallidipes (tsetse fly) Gpa-Mir-929_5p (mature (co-guide))
Heliconius melpomene hme-miR-929
Polistes canadensis pca-miR-929-5p

Relationships