Gorilla gorilla gorilla ggo-miR-361 (MIR361)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-361 (MIR361) URS00000CF1D2_9595

22 nucleotides
1 database (RefSeq)
Found in 23 other species
20 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

Bos taurus (cattle) bta-miR-361
Callithrix jacchus cja-miR-361
Canis lupus familiaris (dog) cfa-miR-361
Capra hircus (goat) chi-miR-361-5p
Cavia porcellus (domestic guinea pig) cpo-miR-361-5p
Cervus elaphus (red deer) cel-miR-361
Cricetulus griseus cgr-miR-361
Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
Eptesicus fuscus efu-miR-361
Equus caballus (horse) eca-miR-361-5p
Gorilla gorilla ggo-miR-361
Homo sapiens (human) hsa-miR-361-5p
Macaca mulatta mml-miR-361-5p
Microcebus murinus (gray mouse lemur) mmr-miR-361
Mus musculus mmu-miR-361-5p
Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-361
Oryctolagus cuniculus ocu-miR-361-5p
Otolemur garnettii oga-miR-361
Pongo pygmaeus (Bornean orangutan) ppy-miR-361-5p
Pteropus alecto pal-miR-361-5p
Rattus norvegicus rno-miR-361-5p
Sus scrofa ssc-miR-361-5p

Publications