Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-361 URS00000CF1D2_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Bos taurus (cattle) bta-miR-361
  2. Callithrix jacchus cja-miR-361
  3. Canis lupus familiaris (dog) cfa-miR-361
  4. Capra hircus (goat) chi-miR-361-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-361-5p
  6. Cervus elaphus (red deer) cel-miR-361
  7. Cricetulus griseus cgr-miR-361
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
  10. Eptesicus fuscus efu-miR-361
  11. Equus caballus (horse) eca-miR-361-5p
  12. Gorilla gorilla gorilla ggo-miR-361 (MIR361)
  13. Homo sapiens (human) hsa-miR-361-5p
  14. Macaca mulatta mml-miR-361-5p
  15. Microcebus murinus (gray mouse lemur) mmr-miR-361
  16. Mus musculus mmu-miR-361-5p
  17. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-361
  18. Oryctolagus cuniculus ocu-miR-361-5p
  19. Otolemur garnettii oga-miR-361
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-361-5p
  21. Pteropus alecto pal-miR-361-5p
  22. Rattus norvegicus rno-miR-361-5p
  23. Sus scrofa ssc-miR-361-5p
Publications