Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mizuhopecten yessoensis (Yesso scallop) tRNA-Gln secondary structure diagram

Mizuhopecten yessoensis (Yesso scallop) tRNA-Gln URS00000A9F58_6573

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCUAUGGUGUAAUGGUUAGCACUCAGGACUCUGAAUCCUGCGAUCCGAGUUCAAAUCUCGGUAGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Arctogadus glacialis (Arctic cod) tRNA-Gln
  2. bacterium tRNA-Gln
  3. Boreogadus saida tRNA-Gln
  4. Branchiostoma lanceolatum (Amphioxus) transfer RNA glutamine (anticodon CUG)
  5. Coregonus sp. 'balchen' tRNA
  6. Dallia pectoralis tRNA-OTHER
  7. Desulfobacteraceae bacterium tRNA-Gln
  8. Dissostichus eleginoides tRNA-Gln
  9. Dissostichus mawsoni tRNA
  10. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  11. Drosophila elegans (Pomace flies) tRNA-Gln
  12. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  13. Drosophila eugracilis (Fruit fly) tRNA-Gln
  14. Drosophila ficusphila (Fruit fly) tRNA-Gln
  15. Drosophila guanche (Fruit fly) tRNA-Gln
  16. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  17. Drosophila mauritiana (Fruit fly) tRNA-Gln
  18. Drosophila melanogaster transfer RNA:Glutamine-CTG 3-1 (Dmel_CR31940)
  19. Drosophila miranda (Fruit fly) tRNA-Gln
  20. Drosophila obscura (Fruit fly) tRNA-Gln
  21. Drosophila persimilis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  22. Drosophila pseudoobscura (Fruit fly) tRNA-Gln
  23. Drosophila pseudoobscura pseudoobscura tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  24. Drosophila rhopaloa (Fruit fly) tRNA-Gln
  25. Drosophila santomea (Fruit fly) tRNA-Gln
  26. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  27. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  28. Drosophila subobscura (Fruit fly) tRNA-Gln
  29. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  30. Drosophila suzukii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  31. Drosophila takahashii (Pomace flies) transfer RNA glutamine (anticodon CUG)
  32. Drosophila teissieri (Fruit fly) tRNA-Gln
  33. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  34. Esox lucius (northern pike) tRNA
  35. Gadus morhua 'NCC' tRNA-Gln
  36. Gadus morhua tRNA-Gln (CTG) (tRNA-Gln-CTG-6-1, tRNA-Gln-CTG-6-2)
  37. Gammaproteobacteria bacterium tRNA-Gln
  38. Gymnodraco acuticeps tRNA
  39. Hucho hucho (huchen) tRNA
  40. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015026364.1
  41. marine sediment metagenome tRNA
  42. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon CUG)
  43. Notothenia coriiceps (black rockcod) tRNA
  44. Oncorhynchus kisutch (coho salmon) tRNA
  45. Owenia fusiformis tRNA
  46. Pecten maximus (Great Scallop) tRNA-Gln
  47. Porticoccaceae bacterium tRNA-Gln
  48. Priapulus caudatus tRNA-Gln
  49. Salmo salar (Atlantic salmon) tRNA
  50. Salmo trutta (brown trout) tRNA
  51. Salvelinus namaycush (lake trout) tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications