Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila suzukii (Fruit fly) tRNA-Gln secondary structure diagram

Drosophila suzukii (Fruit fly) tRNA-Gln URS00000A9F58_28584

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCUAUGGUGUAAUGGUUAGCACUCAGGACUCUGAAUCCUGCGAUCCGAGUUCAAAUCUCGGUAGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Arctogadus glacialis (Arctic cod) tRNA-Gln
  2. bacterium tRNA-Gln
  3. Boreogadus saida tRNA-Gln
  4. Branchiostoma lanceolatum (amphioxus) tRNA
  5. Coregonus sp. 'balchen' tRNA
  6. Dallia pectoralis tRNA-OTHER
  7. Dissostichus mawsoni tRNA
  8. Drosophila biarmipes (Fruit fly) transfer RNA glutamine (anticodon CUG)
  9. Drosophila elegans (Fruit fly) tRNA-Gln
  10. Drosophila erecta tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  11. Drosophila eugracilis (Fruit fly) tRNA-Gln
  12. Drosophila ficusphila (Fruit fly) tRNA-Gln
  13. Drosophila guanche (Fruit fly) tRNA-Gln
  14. Drosophila gunungcola (Fruit fly) transfer RNA glutamine (anticodon CUG)
  15. Drosophila mauritiana (Fruit fly) tRNA-Gln
  16. Drosophila melanogaster (fruit fly) transfer RNA:Glutamine-CTG 3-1 (Dmel_CR31940)
  17. Drosophila miranda (Fruit fly) tRNA-Gln
  18. Drosophila obscura (Fruit fly) tRNA-Gln
  19. Drosophila persimilis tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  20. Drosophila pseudoobscura (Fruit fly) tRNA-Gln
  21. Drosophila pseudoobscura pseudoobscura tRNA-Gln (CTG) (tRNA-Gln-CTG-2-1)
  22. Drosophila rhopaloa (Fruit fly) tRNA-Gln
  23. Drosophila santomea (Fruit fly) tRNA-Gln
  24. Drosophila sechellia tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  25. Drosophila simulans tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  26. Drosophila subobscura (Fruit fly) tRNA-Gln
  27. Drosophila subpulchrella (Fruit fly) tRNA-Gln
  28. Drosophila takahashii (Fruit fly) tRNA-Gln
  29. Drosophila teissieri (Fruit fly) tRNA-Gln
  30. Drosophila yakuba tRNA-Gln (CTG) (tRNA-Gln-CTG-3-1)
  31. Esox lucius (northern pike) tRNA
  32. Gadus morhua 'NCC' tRNA-Gln
  33. Gadus morhua tRNA-Gln (CTG) (tRNA-Gln-CTG-6-1, tRNA-Gln-CTG-6-2)
  34. Gymnodraco acuticeps tRNA
  35. Hucho hucho (huchen) tRNA
  36. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015026364.1
  37. Mizuhopecten yessoensis (Yesso scallop) tRNA-Gln
  38. Mya arenaria (Soft-shell clam) transfer RNA glutamine (anticodon CUG)
  39. Notothenia coriiceps (black rockcod) tRNA
  40. Oncorhynchus kisutch (coho salmon) tRNA
  41. Owenia fusiformis tRNA
  42. Pecten maximus (Great Scallop) tRNA-Gln
  43. Priapulus caudatus tRNA-Gln
  44. Salmo salar (Atlantic salmon) tRNA
  45. Salmo trutta (brown trout) tRNA
  46. Salvelinus namaycush (lake trout) tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...