Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-326 URS00000A939F_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-326: ssc-mir-326 is a microRNA that has been identified as significantly differentially expressed between normoxic and hypoxic groups. It is associated with downstream genes related to the extracellular matrix, proteoglycans in cancer, and focal adhesion pathways [PMC8861501]. The ssc-mir-326 rs319154814 (G/A) genotypes have been found to be associated with the levels of this microRNA in the liver [PMC8097994]. The expression levels of several mRNA transcripts associated with ssc-mir-326 genotypes were reduced in pigs homozygous for the mutated allele [PMC8097994]. SNPs mapping to the ssc-miR-23a and ssc-mir-326 genes displayed significant associations with the expression levels of some of their putative mRNA targets [PMC8097994]. The expression level of ssc-mir-326 transcripts in liver tissue was found to be increased in pigs homozygous for the A-allele, although this result was not statistically significant [PMC8097994]. The rs319154814 (G/A) variant in the ssc-mir-326 gene was significantly associated with lipid traits [PMC8097994]. Several hepatic mRNA targets were significantly associated with ssc-mir-326 genotypes, including CFLAR, PPP1CC, SDC1, SF3A3, and FSTL1 [PMC8097994]. There are reports suggesting that several targets of ssc-mir-326 might be involved in carbohydrate and lipid metabolism pathways [PMC8097994]. The rs319154814 (G/A) polymorphism located in the apical loop region of ssc-mir-326 may increase its repressive activity on target genes such as PPP1CC [PMC8097994].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCUGGGCCCUUCCUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Bos taurus (cattle) bta-miR-326
  2. Canis lupus familiaris (dog) cfa-miR-326
  3. Cavia porcellus cpo-miR-326-3p
  4. Dasypus novemcinctus dno-miR-326-3p
  5. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-326_3p (mature (guide))
  6. Gorilla gorilla gorilla ggo-miR-326 (MIR326)
  7. Gorilla gorilla ggo-miR-326
  8. Homo sapiens hsa-miR-326
  9. Macaca fascicularis (crab-eating macaque) microRNA miR-326-3p
  10. Macaca mulatta Mml-Mir-326_3p (mature (guide))
  11. Mus musculus (house mouse) Mmu-Mir-326_3p (mature (guide))
  12. Oryctolagus cuniculus (rabbit) ocu-miR-326-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-326
  14. Pongo pygmaeus ppy-miR-326
  15. Rattus norvegicus Rno-Mir-326_3p (mature (guide))
Publications