v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-let-7d-5p URS00000A07C1_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGGUAGUAGGUUGCAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 70 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c1_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Let-7-P2c1_5p (mature (guide))
  3. Bos taurus (cattle) bta-let-7d
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7d
  5. Callorhinchus milii Cmi-Let-7-P2c1_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Let-7-P2c1_5p (mature (guide))
  7. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
  8. Cervus elaphus (red deer) cel-let-7d
  9. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
  10. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2c1_5p (mature (guide))
  11. Chrysemys picta cpi-let-7d-5p
  12. Columba livia (rock pigeon) cli-let-7d-5p
  13. Cricetulus griseus cgr-let-7d-5p
  14. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
  15. Echinops telfairi Ete-Let-7-P2c1_5p (mature (guide))
  16. Equus caballus (horse) eca-let-7d
  17. Gekko japonicus Gja-Let-7-P2c1_5p (mature (guide))
  18. Homo sapiens (human) hsa-let-7d-5p
  19. Latimeria chalumnae Lch-Let-7-P2c1_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-let-7d
  21. Microcaecilia unicolor Mun-Let-7-P2c1_5p (mature (guide))
  22. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
  23. Mus musculus mmu-let-7d-5p
  24. Ophiophagus hannah (king cobra) oha-let-7d-5p
  25. Ornithorhynchus anatinus oan-let-7d-5p
  26. Oryctolagus cuniculus (rabbit) ocu-let-7d-5p
  27. Pan troglodytes (chimpanzee) ptr-let-7d
  28. Pongo pygmaeus ppy-let-7d
  29. Python bivittatus (Burmese python) pbv-let-7d-5p
  30. Rattus norvegicus rno-let-7d-5p
  31. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
  32. Scyliorhinus torazame (cloudy catshark) Sto-Let-7-P2c1_5p (mature (guide))
  33. Sphenodon punctatus Spt-Let-7-P2c1_5p (mature (guide))
  34. Sus scrofa ssc-let-7d-5p
  35. Taeniopygia guttata tgu-let-7d-5p
 Publications