v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-let-7d-5p URS00000A07C1_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-let-7d: Rno-let-7d is a miRNA that has been found to be upregulated in response to a hyperandrogenic condition in granulosa cells [PMC3682887]. This upregulation is believed to be associated with the downregulation of androgen receptors [PMC3682887]. Rno-let-7d is also highly abundant in DHT-treated ovaries [PMC3682887]. In addition, rno-let-7d has been found to have experimentally validated targets, including Homer 1a, which may be related to the ADHD phenotype [PMC3682887] [PMC8858317]. Furthermore, rno-let-7d has shown differential expression in adipose tissue of sensitized rats, being upregulated along with rno-miR-423 and downregulated along with rno-miR-99a [PMC7564923]. Animal studies have also demonstrated that miRNA expression of rno-let-7d or its target genes, such as Homer 1a, are associated with ADHD phenotypes in animal models [PMC5987559]. Overall, rno-let-d is a miRNA that plays a role in the regulation of androgen receptors and may have implications for conditions such as hyperandrogenism and ADHD.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGGUAGUAGGUUGCAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c1_5p (mature (guide))
  2. Anolis carolinensis Aca-Let-7-P2c1_5p (mature (guide))
  3. Bos taurus bta-let-7d
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7d
  5. Callorhinchus milii (elephant shark) Cmi-Let-7-P2c1_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
  7. Capra hircus chi-let-7d-5p
  8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
  9. Cervus elaphus cel-let-7d
  10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
  11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-let-7d-5p
  13. Columba livia cli-let-7d-5p
  14. Cricetulus griseus (Chinese hamster) cgr-let-7d-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
  16. Echinops telfairi Ete-Let-7-P2c1_5p (mature (guide))
  17. Equus caballus eca-let-7d
  18. Gekko japonicus Gja-Let-7-P2c1_5p (mature (guide))
  19. Homo sapiens (human) hsa-let-7d-5p
  20. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c1_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-let-7d
  22. Microcaecilia unicolor Mun-Let-7-P2c1_5p (mature (guide))
  23. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
  24. Mus musculus mmu-let-7d-5p
  25. Ophiophagus hannah oha-let-7d-5p
  26. Ornithorhynchus anatinus oan-let-7d-5p
  27. Oryctolagus cuniculus ocu-let-7d-5p
  28. Pan troglodytes ptr-let-7d
  29. Pongo pygmaeus (Bornean orangutan) ppy-let-7d
  30. Python bivittatus (Burmese python) pbv-let-7d-5p
  31. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
  32. Scyliorhinus torazame Sto-Let-7-P2c1_5p (mature (guide))
  33. Sphenodon punctatus Spt-Let-7-P2c1_5p (mature (guide))
  34. Sus scrofa (pig) ssc-let-7d-5p
  35. Taeniopygia guttata (zebra finch) tgu-let-7d-5p
 Publications