v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7d-5p URS00000A07C1_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-let-7d: Mmu-let-7d is a type of microRNA that has been found to be increased during adipogenesis and maturation of 3T3-L1 cells, suggesting its involvement in adipogenesis [PMC5449966]. In fully differentiated 3T3-L1 adipocytes, the expression levels of mmu-let-7d were significantly higher compared to undifferentiated control cells, and the addition of 0.1% ethanol during the process did not affect its expression [PMC5449966]. Mmu-let-7d is also upregulated in response to proton radiation in mouse testis, indicating its potential role in spermatogenesis [PMC6024298]. The bioprocessing of Canis familiaris let-7d differs from mmu-let-7d and other let-7d variants [PMC6531867]. The expression levels of mmu-let-7d were confirmed using real-time PCR and nanostring methods, although there was a discrepancy between the two techniques in some cases [PMC7766432]. Mmu-let-d is categorized as a conserved microRNA, along with hsa-let-d and others, based on their conservation at the nucleotide level [PMC2842251].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGGUAGUAGGUUGCAUAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c1_5p (mature (guide))
  2. Anolis carolinensis Aca-Let-7-P2c1_5p (mature (guide))
  3. Bos taurus bta-let-7d
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7d
  5. Callorhinchus milii (elephant shark) Cmi-Let-7-P2c1_5p (mature (guide))
  6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
  7. Capra hircus chi-let-7d-5p
  8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
  9. Cervus elaphus cel-let-7d
  10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
  11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-let-7d-5p
  13. Columba livia cli-let-7d-5p
  14. Cricetulus griseus (Chinese hamster) cgr-let-7d-5p
  15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
  16. Echinops telfairi Ete-Let-7-P2c1_5p (mature (guide))
  17. Equus caballus eca-let-7d
  18. Gekko japonicus Gja-Let-7-P2c1_5p (mature (guide))
  19. Homo sapiens (human) hsa-let-7d-5p
  20. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c1_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-let-7d
  22. Microcaecilia unicolor Mun-Let-7-P2c1_5p (mature (guide))
  23. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
  24. Ophiophagus hannah oha-let-7d-5p
  25. Ornithorhynchus anatinus oan-let-7d-5p
  26. Oryctolagus cuniculus ocu-let-7d-5p
  27. Pan troglodytes ptr-let-7d
  28. Pongo pygmaeus (Bornean orangutan) ppy-let-7d
  29. Python bivittatus (Burmese python) pbv-let-7d-5p
  30. Rattus norvegicus rno-let-7d-5p
  31. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
  32. Scyliorhinus torazame Sto-Let-7-P2c1_5p (mature (guide))
  33. Sphenodon punctatus Spt-Let-7-P2c1_5p (mature (guide))
  34. Sus scrofa (pig) ssc-let-7d-5p
  35. Taeniopygia guttata (zebra finch) tgu-let-7d-5p
 Publications