Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7d-5p URS00000A07C1_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, GeneCards, TarBase, ENA, miRBase, MirGeneDB, RefSeq, LncBase). Described in 49 papers. Homo sapiens (human) hsa-let-7d-5p sequence is a product of let-7d, hsa-let-7d, let-7d-5p, MIRLET7D, let-7, hsa-let-7d-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 12CC4, 14-3-3GAMMA, 14-3-3γ, 16E1BP, 2'-PDE, 3635, 3D3, 3H11Ag, 4-1BB-L.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGGUAGUAGGUUGCAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 30 other species

    1. Alligator mississippiensis (American alligator) Ami-Let-7-P2c1_5p (mature (guide))
    2. Anolis carolinensis (green anole) Aca-Let-7-P2c1_5p (mature (guide))
    3. Bos taurus (cattle) bta-let-7d
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7d
    5. Callorhinchus milii eshark_let-7_7
    6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
    7. Capra hircus chi-let-7d-5p
    8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
    9. Cervus elaphus cel-let-7d
    10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
    11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
    12. Chrysemys picta cpi-let-7d-5p
    13. Columba livia cli-let-7d-5p
    14. Cricetulus griseus cgr-let-7d-5p
    15. Dasypus novemcinctus dno-let-7d-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2c1_5p (mature (guide))
    17. Equus caballus eca-let-7d
    18. Macaca mulatta mml-let-7d
    19. Monodelphis domestica Mdo-Let-7-P2c1_5p (mature (guide))
    20. Mus musculus mmu-let-7d-5p
    21. Ophiophagus hannah oha-let-7d-5p
    22. Ornithorhynchus anatinus oan-let-7d-5p
    23. Oryctolagus cuniculus ocu-let-7d-5p
    24. Pan troglodytes ptr-let-7d
    25. Pongo pygmaeus ppy-let-7d
    26. Python bivittatus (Burmese python) pbv-let-7d-5p
    27. Rattus norvegicus (Norway rat) rno-let-7d-5p
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P2c1_5p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Let-7-P2c1_5p (mature (guide))
    30. Sus scrofa (pig) ssc-let-7d-5p
    31. Taeniopygia guttata tgu-let-7d-5p