Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) Mdo-Let-7-P2c1_5p (mature (guide)) URS00000A07C1_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGAGGUAGUAGGUUGCAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis Ami-Let-7-P2c1_5p (mature (guide))
    2. Anolis carolinensis Aca-Let-7-P2c1_5p (mature (guide))
    3. Bos taurus (cattle) bta-let-7d
    4. Callithrix jacchus cja-let-7d
    5. Callorhinchus milii (elephant shark) eshark_let-7_7
    6. Canis lupus familiaris Cfa-Let-7-P2c1_5p (mature (guide))
    7. Capra hircus chi-let-7d-5p
    8. Cavia porcellus (domestic guinea pig) cpo-let-7d-5p
    9. Cervus elaphus (red deer) cel-let-7d
    10. Chiloscyllium plagiosum microRNA cpl-let-7d-5p
    11. Chrysemys picta bellii Cpi-Let-7-P2c1_5p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-let-7d-5p
    13. Columba livia (rock pigeon) cli-let-7d-5p
    14. Cricetulus griseus cgr-let-7d-5p
    15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2c1_5p (mature (guide))
    17. Equus caballus (horse) eca-let-7d
    18. Homo sapiens hsa-let-7d-5p
    19. Macaca mulatta mml-let-7d
    20. Mus musculus (house mouse) mmu-let-7d-5p
    21. Ophiophagus hannah oha-let-7d-5p
    22. Ornithorhynchus anatinus oan-let-7d-5p
    23. Oryctolagus cuniculus (rabbit) ocu-let-7d-5p
    24. Pan troglodytes (chimpanzee) ptr-let-7d
    25. Pongo pygmaeus ppy-let-7d
    26. Python bivittatus pbv-let-7d-5p
    27. Rattus norvegicus rno-let-7d-5p
    28. Sarcophilus harrisii Sha-Let-7-P2c1_5p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Let-7-P2c1_5p (mature (guide))
    30. Sus scrofa ssc-let-7d-5p
    31. Taeniopygia guttata (zebra finch) tgu-let-7d-5p