Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-551b-3p URS000008C563_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-551b: Hsa-mir-551b is a microRNA that has been studied in various types of cancer, including lung adenocarcinoma, colorectal cancer, gastric cancer, cholangiocarcinoma, osteosarcoma, hepatocellular carcinoma, and papillary thyroid carcinoma [PMC6563032][PMC8994656]. It has been shown to have different functions in different types of cancer. In lung adenocarcinoma and colorectal cancer, hsa-mir-551b is believed to regulate tumor progression [PMC6563032]. In gastric cancer, hsa-mir-551b-3p is downregulated and may serve as a tumor suppressor [PMC6563032][PMC6129036]. In cholangiocarcinoma cells, hsa-mir-551b-3p inhibits cell growth by targeting Cyclin D1 [PMC6129036][PMC8994656]. Additionally, hsa-mir-551b has been found to be downregulated in colorectal cancer tissues and may function as an anti-oncogene [PMC6129036]. It has also been associated with epithelial-to-mesenchymal transition (EMT), metastasis, and poor prognosis in gastric cancer patients [PMC6129036]. Furthermore, hsa-mir-551b has been predicted to be an upstream regulator of CCND1 [PMC6129036]. Overall, the role of hsa-mir-551b in various cancers is still not fully understood and further studies are needed to elucidate its function within the gene networks of these cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACCCAUACUUGGUUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-551-P2_3p (mature (guide))
  2. Anolis carolinensis aca-miR-551
  3. Bos taurus Bta-Mir-551-P2_3p (mature (guide))
  4. Callithrix jacchus cja-miR-551
  5. Canis lupus familiaris (dog) cfa-miR-551b
  6. Cavia porcellus (domestic guinea pig) cpo-miR-551-3p
  7. Chrysemys picta bellii Cpi-Mir-551-P2_3p (mature (guide))
  8. Chrysemys picta cpi-miR-551-2-3p
  9. Columba livia Cli-Mir-551-P2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-551b-3p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-551-P2_3p (mature (guide))
  12. Equus caballus eca-miR-551b
  13. Gallus gallus gga-miR-551-3p
  14. Gekko japonicus Gja-Mir-551-P2_3p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-551b (MIR551B)
  16. Gorilla gorilla ggo-miR-551b
  17. Macaca mulatta mml-miR-551b-3p
  18. Microcaecilia unicolor Mun-Mir-551-P2_3p (mature (guide))
  19. Monodelphis domestica (gray short-tailed opossum) mdo-miR-551b-3p
  20. Mus musculus (house mouse) mmu-miR-551b-3p
  21. Ornithorhynchus anatinus oan-miR-551-3p
  22. Oryctolagus cuniculus ocu-miR-551b-3p
  23. Pan troglodytes (chimpanzee) ptr-miR-551b
  24. Pongo pygmaeus ppy-miR-551b
  25. Python bivittatus (Burmese python) pbv-miR-551b-3p
  26. Rattus norvegicus Rno-Mir-551-P2_3p (mature (guide))
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-551-P2_3p (mature (guide))
  28. Sphenodon punctatus Spt-Mir-551-P2_3p (mature (guide))
  29. Taeniopygia guttata tgu-miR-551-3p
Publications