Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-551b-3p URS000008C563_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACCCAUACUUGGUUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-551-P2_3p (mature (guide))
  2. Anolis carolinensis aca-miR-551
  3. Bos taurus Bta-Mir-551-P2_3p (mature (guide))
  4. Callithrix jacchus cja-miR-551
  5. Canis lupus familiaris (dog) cfa-miR-551b
  6. Cavia porcellus (domestic guinea pig) cpo-miR-551-3p
  7. Chrysemys picta bellii Cpi-Mir-551-P2_3p (mature (guide))
  8. Chrysemys picta cpi-miR-551-2-3p
  9. Columba livia Cli-Mir-551-P2_3p (mature (guide))
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-551-P2_3p (mature (guide))
  11. Equus caballus eca-miR-551b
  12. Gallus gallus gga-miR-551-3p
  13. Gekko japonicus Gja-Mir-551-P2_3p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-551b (MIR551B)
  15. Gorilla gorilla ggo-miR-551b
  16. Homo sapiens hsa-miR-551b-3p
  17. Macaca mulatta mml-miR-551b-3p
  18. Microcaecilia unicolor Mun-Mir-551-P2_3p (mature (guide))
  19. Monodelphis domestica (gray short-tailed opossum) mdo-miR-551b-3p
  20. Mus musculus (house mouse) mmu-miR-551b-3p
  21. Ornithorhynchus anatinus oan-miR-551-3p
  22. Oryctolagus cuniculus ocu-miR-551b-3p
  23. Pan troglodytes (chimpanzee) ptr-miR-551b
  24. Pongo pygmaeus ppy-miR-551b
  25. Python bivittatus (Burmese python) pbv-miR-551b-3p
  26. Rattus norvegicus Rno-Mir-551-P2_3p (mature (guide))
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-551-P2_3p (mature (guide))
  28. Sphenodon punctatus Spt-Mir-551-P2_3p (mature (guide))
  29. Taeniopygia guttata tgu-miR-551-3p