Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-551 URS000008C563_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGACCCAUACUUGGUUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Alligator mississippiensis Ami-Mir-551-P2_3p (mature (guide))
  2. Bos taurus Bta-Mir-551-P2_3p (mature (guide))
  3. Callithrix jacchus cja-miR-551
  4. Canis lupus familiaris (dog) cfa-miR-551b
  5. Cavia porcellus (domestic guinea pig) cpo-miR-551-3p
  6. Chrysemys picta bellii (western painted turtle) Cpi-Mir-551-P2_3p (mature (guide))
  7. Chrysemys picta cpi-miR-551-2-3p
  8. Columba livia Cli-Mir-551-P2_3p (mature (guide))
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-551b-3p
  10. Echinops telfairi Ete-Mir-551-P2_3p (mature (guide))
  11. Equus caballus (horse) eca-miR-551b
  12. Gallus gallus gga-miR-551-3p
  13. Gekko japonicus Gja-Mir-551-P2_3p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-551b (MIR551B)
  15. Gorilla gorilla (western gorilla) ggo-miR-551b
  16. Homo sapiens (human) hsa-miR-551b-3p
  17. Macaca mulatta mml-miR-551b-3p
  18. Microcaecilia unicolor Mun-Mir-551-P2_3p (mature (guide))
  19. Monodelphis domestica mdo-miR-551b-3p
  20. Mus musculus mmu-miR-551b-3p
  21. Ornithorhynchus anatinus (platypus) oan-miR-551-3p
  22. Oryctolagus cuniculus ocu-miR-551b-3p
  23. Pan troglodytes (chimpanzee) ptr-miR-551b
  24. Pongo pygmaeus ppy-miR-551b
  25. Python bivittatus (Burmese python) pbv-miR-551b-3p
  26. Rattus norvegicus Rno-Mir-551-P2_3p (mature (guide))
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-551-P2_3p (mature (guide))
  28. Sphenodon punctatus Spt-Mir-551-P2_3p (mature (guide))
  29. Taeniopygia guttata tgu-miR-551-3p
Publications