Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-154-5p URS000008931A_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUUAUCCGUGUUGCCUUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-154-5p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-154-5p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-154a-5p
  4. Echinops telfairi Ete-Mir-154-P1_5p (mature (co-guide))
  5. Equus caballus (horse) eca-miR-154a
  6. Gorilla gorilla gorilla ggo-miR-154 (MIR154)
  7. Gorilla gorilla (western gorilla) ggo-miR-154
  8. Homo sapiens (human) hsa-miR-154-5p
  9. Macaca nemestrina mne-miR-154
  10. Mus musculus mmu-miR-154-5p
  11. Oryctolagus cuniculus ocu-miR-154-5p
  12. Pan paniscus (pygmy chimpanzee) ppa-miR-154
  13. Pan troglodytes (chimpanzee) ptr-miR-154
  14. Pongo pygmaeus ppy-miR-154
  15. Rattus norvegicus rno-miR-154-5p
Publications