Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-154-5p URS000008931A_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUUAUCCGUGUUGCCUUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-154-5p
  2. Cricetulus griseus cgr-miR-154-5p
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-154a-5p
  4. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P1_5p (mature (co-guide))
  5. Equus caballus eca-miR-154a
  6. Gorilla gorilla gorilla ggo-miR-154 (MIR154)
  7. Gorilla gorilla ggo-miR-154
  8. Homo sapiens hsa-miR-154-5p
  9. Macaca mulatta mml-miR-154-5p
  10. Macaca nemestrina mne-miR-154
  11. Mus musculus (house mouse) mmu-miR-154-5p
  12. Oryctolagus cuniculus ocu-miR-154-5p
  13. Pan paniscus ppa-miR-154
  14. Pan troglodytes (chimpanzee) ptr-miR-154
  15. Pongo pygmaeus ppy-miR-154
Publications