Dasypus novemcinctus (nine-banded armadillo) dno-miR-154a-5p URS000008931A_9361

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 15 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGGUUAUCCGUGUUGCCUUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Cavia porcellus (domestic guinea pig) cpo-miR-154-5p
2. Cricetulus griseus cgr-miR-154-5p
3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P1_5p (mature (co-guide))
4. Equus caballus eca-miR-154a
5. Gorilla gorilla gorilla ggo-miR-154 (MIR154)
6. Gorilla gorilla ggo-miR-154
7. Homo sapiens hsa-miR-154-5p
8. Macaca mulatta mml-miR-154-5p
9. Macaca nemestrina mne-miR-154
10. Mus musculus (house mouse) mmu-miR-154-5p
11. Oryctolagus cuniculus ocu-miR-154-5p
12. Pan paniscus ppa-miR-154
13. Pan troglodytes (chimpanzee) ptr-miR-154
14. Pongo pygmaeus ppy-miR-154
15. Rattus norvegicus rno-miR-154-5p

Download

• FASTA
• JSON