Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-19a URS000006FDD4_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-19a: Bta-mir-19a is a differentially expressed (DE) miRNA that is upregulated in both non-pregnant and pregnant cows, along with bta-mir-19b, while several other miRNAs, including bta-miR-30a-5p and various bta-miR-2284 families, are downregulated [PMC7458322]. Bta-mir-19a and bta-miR-19b are associated with various biological functions such as cytoskeleton organization, cell junction formation, vasculogenesis, cell proliferation, oxidative stress response, immune response regulation, and ATP synthesis [PMC7458322]. In a transcriptome analysis of miRNAs using RNA sequencing in cows, bta-mir-19a is one of the 11 differentially expressed miRNAs found in both pregnant and non-pregnant cows [PMC7458322]. Bta-mir-19a has been reported to target genes such as HSPBAP1, DNAJB1, HPX (heat stress response genes), PLA2R1 (involved in heat stress response through oxidation), and PICEN [PMC7458322]. In a comparison of differentially expressed miRNAs between groups of cows (non-pregnant vs. pregnant), several DE miRNAs were identified including bta-mir-221 (shared between all groups), bta-mir-1247-5p (in H_SCM comparison), and 9 DE miRNAs in the ARM_SCM comparison [PMC10000098]. Bovine studies have also associated other candidate miRNAs such as bta-miR-21-5p with Wnt signals and MAPK pathway regulation [PMC9445238].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Callithrix jacchus cja-miR-19a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-19-P1a-v1_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-19a
  7. Capra hircus (goat) chi-miR-19a
  8. Cavia porcellus cpo-miR-19a-3p
  9. Cervus elaphus cel-miR-19a
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-19a-3p
  12. Cricetulus griseus cgr-miR-19a
  13. Danio rerio dre-miR-19a-3p
  14. Dasypus novemcinctus dno-miR-19a-3p
  15. Echinops telfairi Ete-Mir-19-P1a_3p (mature (guide))
  16. Equus caballus eca-miR-19a
  17. Gadus morhua gmo-miR-19a-3p
  18. Gallus gallus (chicken) gga-miR-19a-3p
  19. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  21. Gorilla gorilla ggo-miR-19a
  22. Homo sapiens hsa-miR-19a-3p
  23. Lagothrix lagotricha lla-miR-19a
  24. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  25. Lemur catta (Ring-tailed lemur) lca-miR-19a
  26. Macaca mulatta mml-miR-19a-3p
  27. Macaca nemestrina mne-miR-19a
  28. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  30. Monopterus albus (swamp eel) Mal-Mir-19-P1a2_3p (mature (guide))
  31. Mus musculus mmu-miR-19a-3p
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  33. Ophiophagus hannah oha-miR-19a-3p
  34. Ornithorhynchus anatinus oan-miR-19a-3p
  35. Oryctolagus cuniculus ocu-miR-19a-3p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus ppa-miR-19a
  38. Pan troglodytes ptr-miR-19a
  39. Pongo pygmaeus ppy-miR-19a
  40. Python bivittatus (Burmese python) pbv-miR-19a-3p
  41. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides (Thai mahseer) miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
Publications