Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-19a-3p URS000006FDD4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-19a: Hsa-mir-19a is one of the key miRNAs identified in the study [PMC4118176]. It is a microRNA that plays a significant role in various biological processes. The study found that hsa-mir-19a, along with hsa-miR-181c and hsa-miR-19b, had higher degrees in the network diagram [PMC4118176]. The researchers performed Q-RT-PCR analysis for miR-19a and miR-19b using specific primers for hsa-mir-19a and hsa-mir-19b [PMC4139485]. This analysis allowed them to measure the expression levels of these microRNAs. Hsa-mir-19a is a member of the miR-17~92 cluster, which is known to be involved in various biological processes, including cell proliferation, apoptosis, and development [PMC4118176]. It has been found to be dysregulated in several diseases, including cancer. In cancer research, hsa-mir-19a has been shown to act as an oncogene by promoting cell proliferation and inhibiting apoptosis [PMC4118176]. The study's findings regarding the higher degrees of hsa-miR181c, hsa-mir-19a, and hsa-miR-19b in the network diagram suggest their potential importance in cellular processes [PMC4118176]. The QRT–PCR analysis using specific primers for these microRNAs allowed for accurate measurement of their expression levels [PMC4139485]. In conclusion, hsa-mir– 19a is an important microRNA involved in various biological processes. Its dysregulation has been implicated in diseases such as cancer. The study's findings highlight its significance along with other key miRNAs identified through network analysis [PMC4118176]. The QRT–PCR analysis using specific primers for hsa-mir-19a provided valuable insights into its expression levels [PMC4139485].

mRNA interactions 18 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Bos taurus bta-miR-19a
  5. Callithrix jacchus cja-miR-19a
  6. Callorhinchus milii (elephant shark) Cmi-Mir-19-P1a-v1_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-19a
  8. Capra hircus (goat) chi-miR-19a
  9. Cavia porcellus cpo-miR-19a-3p
  10. Cervus elaphus cel-miR-19a
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  12. Columba livia (rock pigeon) cli-miR-19a-3p
  13. Cricetulus griseus cgr-miR-19a
  14. Danio rerio dre-miR-19a-3p
  15. Dasypus novemcinctus dno-miR-19a-3p
  16. Echinops telfairi Ete-Mir-19-P1a_3p (mature (guide))
  17. Equus caballus eca-miR-19a
  18. Gadus morhua gmo-miR-19a-3p
  19. Gallus gallus (chicken) gga-miR-19a-3p
  20. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  22. Gorilla gorilla ggo-miR-19a
  23. Lagothrix lagotricha lla-miR-19a
  24. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  25. Lemur catta (Ring-tailed lemur) lca-miR-19a
  26. Macaca mulatta mml-miR-19a-3p
  27. Macaca nemestrina mne-miR-19a
  28. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  30. Monopterus albus (swamp eel) Mal-Mir-19-P1a2_3p (mature (guide))
  31. Mus musculus mmu-miR-19a-3p
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  33. Ophiophagus hannah oha-miR-19a-3p
  34. Ornithorhynchus anatinus oan-miR-19a-3p
  35. Oryctolagus cuniculus ocu-miR-19a-3p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus ppa-miR-19a
  38. Pan troglodytes ptr-miR-19a
  39. Pongo pygmaeus ppy-miR-19a
  40. Python bivittatus (Burmese python) pbv-miR-19a-3p
  41. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides (Thai mahseer) miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
Publications