Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-19a-3p URS000006FDD4_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, IntAct, miRBase, GeneCards, RefSeq, TarBase, MalaCards, MirGeneDB, ENA, PSICQUIC). Described in 99 papers. Homo sapiens (human) hsa-miR-19a-3p sequence is a product of MIR19A, 19, 19a, hsa-miR-19a-3p, hsa-miR-19a, miR-19, miR-19a-3p, miR-19a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 156DAG, 1700010H15RiK, 182-FIP, 1A1-3B, 4EHP, 5'OY11.1, 7h3.

Interactions 33

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-19a-3p interacts with:

Interaction id Participant Synonyms
EBI-20558538 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-21018460 intact:EBI-21017498 EBI-21017498 ENST00000295113 mrna_frzt
EBI-22049657 intact:EBI-22034013 EBI-22034013 ENST00000380659 mrna_tlr7
EBI-22049721 intact:EBI-22049731 EBI-22049731 ENST00000449264 mrna_tnf
EBI-22180315 intact:EBI-22180317 EBI-22180317 ENST00000606080 mrna_frk
URS000006FDD4_9606-15 O15524 O15524
URS000006FDD4_9606-0 O15524 O15524
URS000006FDD4_9606-2 O60603 O60603
URS000006FDD4_9606-1 O60603 O60603
URS000006FDD4_9606-17 O60603 O60603
URS000006FDD4_9606-16 O60603 O60603
URS000006FDD4_9606-19 P01375 P01375
URS000006FDD4_9606-18 P01375 P01375
URS000006FDD4_9606-3 P01375 P01375
URS000006FDD4_9606-4 P01375 P01375
URS000006FDD4_9606-20 P08588 P08588
URS000006FDD4_9606-5 P08588 P08588
URS000006FDD4_9606-6 P17302 P17302
URS000006FDD4_9606-21 P17302 P17302
URS000006FDD4_9606-8 P20273 P20273
URS000006FDD4_9606-22 P20273 P20273
URS000006FDD4_9606-7 P20273 P20273
URS000006FDD4_9606-23 P51608 P51608
URS000006FDD4_9606-9 P51608 P51608
URS000006FDD4_9606-10 Q13485 Q13485
URS000006FDD4_9606-11 Q13562 Q13562
URS000006FDD4_9606-24 Q13562 Q13562
URS000006FDD4_9606-12 Q15818 Q15818
URS000006FDD4_9606-25 Q15818 Q15818
URS000006FDD4_9606-13 Q8NFP9 Q8NFP9
URS000006FDD4_9606-26 Q8NFP9 Q8NFP9
URS000006FDD4_9606-27 Q9NYK1 Q9NYK1
URS000006FDD4_9606-14 Q9NYK1 Q9NYK1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUGCAAAUCUAUGCAAAACUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 66 other species

    1. Alligator mississippiensis Ami-Mir-19-P1_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-19-P1_3p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
    4. Bos taurus (cattle) bta-miR-19a
    5. Callithrix jacchus cja-miR-19a
    6. Canis lupus familiaris cfa-miR-19a
    7. Capra hircus chi-miR-19a
    8. Cavia porcellus (domestic guinea pig) cpo-miR-19a-3p
    9. Cervus elaphus (red deer) cel-miR-19a
    10. Chrysemys picta bellii Cpi-Mir-19-P1_3p (mature (guide))
    11. Columba livia (rock pigeon) cli-miR-19a-3p
    12. Cricetulus griseus cgr-miR-19a
    13. Danio rerio (zebrafish) dre-miR-19a-3p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-19a-3p
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P1_3p (mature (guide))
    16. Equus caballus (horse) eca-miR-19a
    17. Gadus morhua gmo-miR-19a-3p
    18. Gallus gallus (chicken) gga-miR-19a-3p
    19. Gorilla gorilla (western gorilla) ggo-miR-19a
    20. Lagothrix lagotricha lla-miR-19a
    21. Lemur catta lca-miR-19a
    22. Macaca mulatta mml-miR-19a-3p
    23. Macaca nemestrina (pig-tailed macaque) mne-miR-19a
    24. Monodelphis domestica mdo-miR-19a-3p
    25. Mus musculus (house mouse) mmu-miR-19a-3p
    26. Nomascus leucogenys nle-miR-19a
    27. Ophiophagus hannah oha-miR-19a-3p
    28. Ornithorhynchus anatinus oan-miR-19a-3p
    29. Oryctolagus cuniculus (rabbit) ocu-miR-19a-3p
    30. Ovis aries miscellaneous RNA
    31. Pan paniscus ppa-miR-19a
    32. Pan troglodytes (chimpanzee) ptr-miR-19a
    33. Pongo pygmaeus ppy-miR-19a
    34. Python bivittatus pbv-miR-19a-3p
    35. Rattus norvegicus rno-miR-19a-3p
    36. Saguinus labiatus sla-miR-19a
    37. Sarcophilus harrisii Sha-Mir-19-P1_3p (mature (guide))
    38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-19-P1_3p (mature (guide))
    39. Sus scrofa ssc-miR-19a
    40. Takifugu rubripes (torafugu) fru-miR-19a
    41. Tetraodon nigroviridis tni-miR-19a
    42. Tor tambroides miR-19a-3p
    43. Tupaia chinensis tch-miR-19a-3p
    44. Xenopus tropicalis xtr-miR-19a