Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) Aca-Mir-19-P1a_3p (mature (guide)) URS000006FDD4_28377

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis Ami-Mir-19-P1a_3p (mature (guide))
  2. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  3. Bos taurus bta-miR-19a
  4. Callithrix jacchus cja-miR-19a
  5. Callorhinchus milii (elephant shark) Cmi-Mir-19-P1a-v1_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-19a
  7. Capra hircus (goat) chi-miR-19a
  8. Cavia porcellus cpo-miR-19a-3p
  9. Cervus elaphus cel-miR-19a
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-19a-3p
  12. Cricetulus griseus cgr-miR-19a
  13. Danio rerio dre-miR-19a-3p
  14. Dasypus novemcinctus dno-miR-19a-3p
  15. Echinops telfairi Ete-Mir-19-P1a_3p (mature (guide))
  16. Equus caballus eca-miR-19a
  17. Gadus morhua gmo-miR-19a-3p
  18. Gallus gallus (chicken) gga-miR-19a-3p
  19. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  21. Gorilla gorilla ggo-miR-19a
  22. Homo sapiens hsa-miR-19a-3p
  23. Lagothrix lagotricha lla-miR-19a
  24. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  25. Lemur catta (Ring-tailed lemur) lca-miR-19a
  26. Macaca mulatta mml-miR-19a-3p
  27. Macaca nemestrina mne-miR-19a
  28. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  30. Monopterus albus (swamp eel) Mal-Mir-19-P1a2_3p (mature (guide))
  31. Mus musculus mmu-miR-19a-3p
  32. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  33. Ophiophagus hannah oha-miR-19a-3p
  34. Ornithorhynchus anatinus oan-miR-19a-3p
  35. Oryctolagus cuniculus ocu-miR-19a-3p
  36. Ovis aries (sheep) miscellaneous RNA
  37. Pan paniscus ppa-miR-19a
  38. Pan troglodytes ptr-miR-19a
  39. Pongo pygmaeus ppy-miR-19a
  40. Python bivittatus (Burmese python) pbv-miR-19a-3p
  41. Rattus norvegicus (Norway rat) rno-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides (Thai mahseer) miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a