Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-19a-3p URS000006FDD4_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-19a: Rno-mir-19a is a type of microRNA that has been studied in various contexts. In one study, the sequences of rno-mir-19a mimics were identified as 5′-UGU GCA AAU CUA UGC AAA ACU GA-3′ and 5′-AGU UUU GCA UAG AUU UGC ACA UU-3′ [PMC5247685]. Another study found that rno-mir-19a, along with rno-miR-19b-2, rno-miR-137, and rno-miR-214, were downregulated at all four time-points [PMC5064799]. These miRNAs were predicted by multiple databases and selected for validation [PMC5064799]. The expression of rno-mir-19a, along with rno-miR-137, rno-miR-19b2, and rno-miR214, as well as their target genes EGR2 and ARC, were shown to be regulated by propofol in primary cultured embryonic NSCs [PMC5064799]. The fold-change in the mean expression levels of these miRNAs ranged from -2.33 to -6.68 for rno-mir19a [PMC5064799]. Additionally, another study found that exosomes derived from MSCs overexpressing GATA4 were enriched in rnomir19a and may promote increased cardiac muscle cell survival in a hypoxic environment [PMC6406975]. These findings suggest that propofol may have the ability to regulate the expression of rnomir19a and other miRNAs in various contexts.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCAAAUCUAUGCAAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-19-P1a_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-19-P1a_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-19a
  4. Bos taurus bta-miR-19a
  5. Callithrix jacchus cja-miR-19a
  6. Callorhinchus milii Cmi-Mir-19-P1a-v1_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-19a
  8. Capra hircus chi-miR-19a
  9. Cavia porcellus (domestic guinea pig) cpo-miR-19a-3p
  10. Cervus elaphus cel-miR-19a
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P1a_3p (mature (guide))
  12. Columba livia cli-miR-19a-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-19a
  14. Danio rerio dre-miR-19a-3p
  15. Dasypus novemcinctus dno-miR-19a-3p
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-19-P1a_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-19a
  18. Gadus morhua (Atlantic cod) gmo-miR-19a-3p
  19. Gallus gallus (chicken) gga-miR-19a-3p
  20. Gekko japonicus Gja-Mir-19-P1a_3p (mature (guide))
  21. Gorilla gorilla gorilla ggo-miR-19a (MIR19A)
  22. Gorilla gorilla ggo-miR-19a
  23. Homo sapiens (human) hsa-miR-19a-3p
  24. Lagothrix lagotricha (brown woolly monkey) lla-miR-19a
  25. Latimeria chalumnae Lch-Mir-19-P1a_3p (mature (guide))
  26. Lemur catta (Ring-tailed lemur) lca-miR-19a
  27. Macaca mulatta mml-miR-19a-3p
  28. Macaca nemestrina (pig-tailed macaque) mne-miR-19a
  29. Microcaecilia unicolor Mun-Mir-19-P1a_3p (mature (guide))
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19a-3p
  31. Monopterus albus Mal-Mir-19-P1a2_3p (mature (guide))
  32. Mus musculus (house mouse) mmu-miR-19a-3p
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-19a
  34. Ophiophagus hannah oha-miR-19a-3p
  35. Ornithorhynchus anatinus oan-miR-19a-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-19a-3p
  37. Ovis aries (sheep) miscellaneous RNA
  38. Pan paniscus (pygmy chimpanzee) ppa-miR-19a
  39. Pan troglodytes (chimpanzee) ptr-miR-19a
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-19a
  41. Python bivittatus pbv-miR-19a-3p
  42. Saguinus labiatus (red-chested mustached tamarin) sla-miR-19a
  43. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-19-P1a_3p (mature (guide))
  44. Scyliorhinus torazame Sto-Mir-19-P1a-v1_3p (mature (guide))
  45. Sphenodon punctatus (tuatara) Spt-Mir-19-P1a_3p (mature (guide))
  46. Sus scrofa (pig) ssc-miR-19a
  47. Takifugu rubripes (torafugu) fru-miR-19a
  48. Tetraodon nigroviridis tni-miR-19a
  49. Tor tambroides miR-19a-3p
  50. Tupaia chinensis tch-miR-19a-3p
  51. Xenopus laevis (African clawed frog) Xla-Mir-19-P1a4_3p (mature (co-guide))
  52. Xenopus tropicalis xtr-miR-19a
Publications